\
| Variant ID: vg1226541718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26541718 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTAGGTTAATTTAAACAATTTCTTCTGGCAATTTATTCAACAAATTTTAAAGCAAGACGAAAGGGATAAACTTCAGGGCATGACACACGTGCACCATAAC[T/C]
AATAGATTCTAGTTGAGAAGATGGATTTTTTTTTCTAAAAATATACGTTTTTTTGACCGAAATTGCAATAATATATTGAGTAGGGAAAGATTTACCAAAA
TTTTGGTAAATCTTTCCCTACTCAATATATTATTGCAATTTCGGTCAAAAAAACGTATATTTTTAGAAAAAAAAATCCATCTTCTCAACTAGAATCTATT[A/G]
GTTATGGTGCACGTGTGTCATGCCCTGAAGTTTATCCCTTTCGTCTTGCTTTAAAATTTGTTGAATAAATTGCCAGAAGAAATTGTTTAAATTAACCTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 3.40% | 1.54% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 85.20% | 10.50% | 4.30% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.30% | 0.67% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 75.90% | 16.20% | 7.95% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226541718 | T -> C | LOC_Os12g42710.1 | downstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:38.437; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1226541718 | T -> C | LOC_Os12g42720.1 | downstream_gene_variant ; 1750.0bp to feature; MODIFIER | silent_mutation | Average:38.437; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1226541718 | T -> C | LOC_Os12g42710-LOC_Os12g42720 | intergenic_region ; MODIFIER | silent_mutation | Average:38.437; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226541718 | 8.90E-06 | NA | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226541718 | 5.25E-06 | NA | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226541718 | 4.97E-06 | NA | mr1864_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |