\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226193413:

Variant ID: vg1226193413 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26193413
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, A: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CAAACATTCTATTCTTCTAATATATTGATGTGTAATTTTTTTGCGCGTTCGAGAAAAAAAAACTGTTGCTCACAGTGTCATTTGCAAATGGACGCACTGT[A/C]
AATGAGTTAGGTTGCCAGTCCGGATGGAACTTAATTACTTAATTACTAGCTAGTAGTCTTCCCTTCAGCTTGATAATACCTATTATTTTACACAGTAACA

Reverse complement sequence

TGTTACTGTGTAAAATAATAGGTATTATCAAGCTGAAGGGAAGACTACTAGCTAGTAATTAAGTAATTAAGTTCCATCCGGACTGGCAACCTAACTCATT[T/G]
ACAGTGCGTCCATTTGCAAATGACACTGTGAGCAACAGTTTTTTTTTCTCGAACGCGCAAAAAAATTACACATCAATATATTAGAAGAATAGAATGTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.80% 0.23% 0.00% NA
All Indica  2759 93.00% 6.70% 0.29% 0.00% NA
All Japonica  1512 6.30% 93.70% 0.00% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 94.60% 4.50% 0.86% 0.00% NA
Indica III  913 92.10% 7.80% 0.11% 0.00% NA
Indica Intermediate  786 93.30% 6.50% 0.25% 0.00% NA
Temperate Japonica  767 11.00% 89.00% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226193413 A -> C LOC_Os12g42220.1 downstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:45.641; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1226193413 A -> C LOC_Os12g42210-LOC_Os12g42220 intergenic_region ; MODIFIER silent_mutation Average:45.641; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226193413 NA 6.45E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 1.30E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 2.43E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 2.68E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 3.51E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 3.94E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 1.70E-16 mr1579 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 7.73E-16 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 1.05E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 2.28E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 1.12E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 5.82E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 1.26E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 5.13E-06 2.41E-21 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 9.71E-06 9.71E-06 mr1657_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 2.27E-23 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226193413 NA 9.87E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251