Variant ID: vg1226169508 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 26169508 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACCATTTAAAATTTATTTGTAAATATAAGAAATTTTAGAGTACTAGTAATTCCCATATTAATTACCTCATATTAATCATATTGATTTTTCTATCCTATC[C/A]
TCAACTATCAGGGCATAAACCATACCTCATTTACCTCATTTAATGAGGAACACCGGAATCTTTTCTTCCTAACCTTAATATCTACTATAAATAACTAAAT
ATTTAGTTATTTATAGTAGATATTAAGGTTAGGAAGAAAAGATTCCGGTGTTCCTCATTAAATGAGGTAAATGAGGTATGGTTTATGCCCTGATAGTTGA[G/T]
GATAGGATAGAAAAATCAATATGATTAATATGAGGTAATTAATATGGGAATTACTAGTACTCTAAAATTTCTTATATTTACAAATAAATTTTAAATGGTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1226169508 | C -> A | LOC_Os12g42200.1 | upstream_gene_variant ; 3363.0bp to feature; MODIFIER | silent_mutation | Average:40.888; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
vg1226169508 | C -> A | LOC_Os12g42190-LOC_Os12g42200 | intergenic_region ; MODIFIER | silent_mutation | Average:40.888; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1226169508 | NA | 9.05E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1226169508 | 3.69E-06 | NA | mr1124 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1226169508 | 2.47E-06 | 2.47E-06 | mr1200 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1226169508 | 7.45E-06 | 9.65E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1226169508 | 1.10E-06 | 1.10E-06 | mr1861 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |