\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226040946:

Variant ID: vg1226040946 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26040946
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.10, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGGGTGATAATTTTTTGGGGTGGGCTATTTGCAAATAGCCCTCCTGTTTGGATCCCCTTGAGCTATTTTAGGGCTAAAAGGGGTGGGCTAAAAAAAAA[C/A]
CATAGGATCCAAACACCCCCATAGATGAGCACATGTATAGAAAACATCGATTATTTCTAGCTCGTAGGACTCTACATGTTATGTTGGGAATACTGTGGAA

Reverse complement sequence

TTCCACAGTATTCCCAACATAACATGTAGAGTCCTACGAGCTAGAAATAATCGATGTTTTCTATACATGTGCTCATCTATGGGGGTGTTTGGATCCTATG[G/T]
TTTTTTTTTAGCCCACCCCTTTTAGCCCTAAAATAGCTCAAGGGGATCCAAACAGGAGGGCTATTTGCAAATAGCCCACCCCAAAAAATTATCACCCTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.20% 0.21% 0.00% NA
All Indica  2759 90.30% 9.40% 0.33% 0.00% NA
All Japonica  1512 0.50% 99.40% 0.07% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 91.60% 8.20% 0.17% 0.00% NA
Indica II  465 93.10% 6.00% 0.86% 0.00% NA
Indica III  913 90.90% 9.00% 0.11% 0.00% NA
Indica Intermediate  786 86.90% 12.70% 0.38% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226040946 C -> A LOC_Os12g41990.1 upstream_gene_variant ; 483.0bp to feature; MODIFIER silent_mutation Average:46.696; most accessible tissue: Callus, score: 82.614 N N N N
vg1226040946 C -> A LOC_Os12g42000.1 upstream_gene_variant ; 3274.0bp to feature; MODIFIER silent_mutation Average:46.696; most accessible tissue: Callus, score: 82.614 N N N N
vg1226040946 C -> A LOC_Os12g42010.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:46.696; most accessible tissue: Callus, score: 82.614 N N N N
vg1226040946 C -> A LOC_Os12g41990-LOC_Os12g42000 intergenic_region ; MODIFIER silent_mutation Average:46.696; most accessible tissue: Callus, score: 82.614 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226040946 NA 1.15E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 2.35E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 2.22E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 3.24E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 1.44E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 4.27E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 2.93E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 5.01E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 3.94E-15 mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 1.73E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 5.92E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 2.66E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 1.97E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 2.21E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 4.63E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 1.07E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 7.20E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 9.64E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 1.39E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 9.61E-07 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226040946 NA 4.24E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251