\
| Variant ID: vg1226040946 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26040946 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.10, others allele: 0.00, population size: 99. )
TGAGGGTGATAATTTTTTGGGGTGGGCTATTTGCAAATAGCCCTCCTGTTTGGATCCCCTTGAGCTATTTTAGGGCTAAAAGGGGTGGGCTAAAAAAAAA[C/A]
CATAGGATCCAAACACCCCCATAGATGAGCACATGTATAGAAAACATCGATTATTTCTAGCTCGTAGGACTCTACATGTTATGTTGGGAATACTGTGGAA
TTCCACAGTATTCCCAACATAACATGTAGAGTCCTACGAGCTAGAAATAATCGATGTTTTCTATACATGTGCTCATCTATGGGGGTGTTTGGATCCTATG[G/T]
TTTTTTTTTAGCCCACCCCTTTTAGCCCTAAAATAGCTCAAGGGGATCCAAACAGGAGGGCTATTTGCAAATAGCCCACCCCAAAAAATTATCACCCTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 90.30% | 9.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 90.90% | 9.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 67.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226040946 | C -> A | LOC_Os12g41990.1 | upstream_gene_variant ; 483.0bp to feature; MODIFIER | silent_mutation | Average:46.696; most accessible tissue: Callus, score: 82.614 | N | N | N | N |
| vg1226040946 | C -> A | LOC_Os12g42000.1 | upstream_gene_variant ; 3274.0bp to feature; MODIFIER | silent_mutation | Average:46.696; most accessible tissue: Callus, score: 82.614 | N | N | N | N |
| vg1226040946 | C -> A | LOC_Os12g42010.1 | downstream_gene_variant ; 4712.0bp to feature; MODIFIER | silent_mutation | Average:46.696; most accessible tissue: Callus, score: 82.614 | N | N | N | N |
| vg1226040946 | C -> A | LOC_Os12g41990-LOC_Os12g42000 | intergenic_region ; MODIFIER | silent_mutation | Average:46.696; most accessible tissue: Callus, score: 82.614 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226040946 | NA | 1.15E-48 | mr1063 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 2.35E-17 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 2.22E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 3.24E-41 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 1.44E-26 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 4.27E-19 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 2.93E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 5.01E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 3.94E-15 | mr1657 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 1.73E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 5.92E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 2.66E-16 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 1.97E-06 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 2.21E-21 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 4.63E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 1.07E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 7.20E-22 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 9.64E-34 | mr1571_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 1.39E-11 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 9.61E-07 | mr1672_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226040946 | NA | 4.24E-25 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |