Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226021392:

Variant ID: vg1226021392 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26021392
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.39, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGATAGTTGAGTGTAAAATAAGAAGAAATCTGAATGAGAAGTGATTAATGAGACCATTAGTATTATATGTGATAATTATTTTGGAACAAATTTAAATC[T/C,A]
TAGAAATATAATTATTATAGGACAAAGGTACTACAGCGAATTTTTATTTCCTTTTTCTTAAATAAAAACTGAACCAAGGTATACTGTTTGGTTTCGATTT

Reverse complement sequence

AAATCGAAACCAAACAGTATACCTTGGTTCAGTTTTTATTTAAGAAAAAGGAAATAAAAATTCGCTGTAGTACCTTTGTCCTATAATAATTATATTTCTA[A/G,T]
GATTTAAATTTGTTCCAAAATAATTATCACATATAATACTAATGGTCTCATTAATCACTTCTCATTCAGATTTCTTCTTATTTTACACTCAACTATCTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	37.40%	0.04%	0.00%	A: 0.85%
All Indica	2759	94.30%	4.60%	0.07%	0.00%	A: 0.94%
All Japonica	1512	0.70%	99.20%	0.00%	0.00%	A: 0.07%
Aus	269	92.90%	3.70%	0.00%	0.00%	A: 3.35%
Indica I	595	92.10%	7.90%	0.00%	0.00%	NA
Indica II	465	94.80%	4.90%	0.00%	0.00%	A: 0.22%
Indica III	913	95.40%	2.40%	0.11%	0.00%	A: 2.08%
Indica Intermediate	786	94.50%	4.60%	0.13%	0.00%	A: 0.76%
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.30%	0.00%	0.00%	A: 0.41%
VI/Aromatic	96	12.50%	83.30%	0.00%	0.00%	A: 4.17%
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226021392	T -> C	LOC_Os12g41962.1	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> C	LOC_Os12g41962.4	upstream_gene_variant ; 372.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> C	LOC_Os12g41962.2	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> C	LOC_Os12g41962.3	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> C	LOC_Os12g41956.1	downstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> C	LOC_Os12g41956-LOC_Os12g41962	intergenic_region ; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41962.1	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41962.4	upstream_gene_variant ; 372.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41962.2	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41962.3	upstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41956.1	downstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N
vg1226021392	T -> A	LOC_Os12g41956-LOC_Os12g41962	intergenic_region ; MODIFIER	silent_mutation	Average:65.525; most accessible tissue: Zhenshan97 root, score: 79.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226021392	NA	2.24E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	3.57E-36	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	6.16E-74	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.66E-38	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.23E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.39E-43	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.17E-35	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.79E-35	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	4.77E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.20E-30	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	4.87E-20	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	7.92E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.89E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.24E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	9.86E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.12E-23	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	5.72E-16	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	4.55E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	6.85E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.69E-45	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	2.16E-45	mr1591_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.89E-70	mr1594_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	NA	1.63E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226021392	4.96E-06	4.96E-06	mr1912_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251