\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225983988:

Variant ID: vg1225983988 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25983988
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTCCTATGGAATGGCACATTGCATGTGAATTGTAGAGAAAATGTAGCAAGAGCTCTAACCTCTTGGGAAATTTCCTTTGAGTCTATCTTTCTCATCT[T/G]
ATTCCTACGTTTTTTCTGCGCTCCAATCAAACGACCATTCATGTGTTTTTCCTGTGTTTTGCAATCCTCTGTTTTACACTTCAATTCCTATCAGAATCCT

Reverse complement sequence

AGGATTCTGATAGGAATTGAAGTGTAAAACAGAGGATTGCAAAACACAGGAAAAACACATGAATGGTCGTTTGATTGGAGCGCAGAAAAAACGTAGGAAT[A/C]
AGATGAGAAAGATAGACTCAAAGGAAATTTCCCAAGAGGTTAGAGCTCTTGCTACATTTTCTCTACAATTCACATGCAATGTGCCATTCCATAGGAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 13.60% 12.46% 34.68% NA
All Indica  2759 7.40% 15.70% 19.75% 57.23% NA
All Japonica  1512 99.30% 0.10% 0.33% 0.26% NA
Aus  269 4.80% 70.60% 11.15% 13.38% NA
Indica I  595 13.10% 10.30% 26.89% 49.75% NA
Indica II  465 6.20% 11.20% 16.56% 66.02% NA
Indica III  913 3.80% 17.60% 18.29% 60.24% NA
Indica Intermediate  786 7.80% 20.10% 17.94% 54.20% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 0.20% 0.79% 0.40% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 9.40% 1.04% 2.08% NA
Intermediate  90 56.70% 14.40% 8.89% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225983988 T -> DEL N N silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41910.1 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41910.2 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41920.1 downstream_gene_variant ; 510.0bp to feature; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41920.2 downstream_gene_variant ; 510.0bp to feature; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41920.3 downstream_gene_variant ; 510.0bp to feature; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N
vg1225983988 T -> G LOC_Os12g41910-LOC_Os12g41920 intergenic_region ; MODIFIER silent_mutation Average:39.824; most accessible tissue: Callus, score: 74.546 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225983988 NA 1.03E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.64E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.60E-38 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 4.22E-76 mr1135 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.87E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 4.22E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.25E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.73E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.35E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.53E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 7.27E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 4.20E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 9.40E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 3.56E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.95E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.05E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.91E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 4.72E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 5.47E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 3.27E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.39E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 8.39E-33 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 5.32E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 2.72E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.10E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.47E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 3.40E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 7.08E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 4.46E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 6.15E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 1.13E-43 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225983988 NA 8.73E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251