\
| Variant ID: vg1225940329 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25940329 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 222. )
TTACACTTCTGTAATAACTGTTGCTGACTTGCTGTACCTGTACATCATTAACCTGTCTAAAATTTTTTCAAATCTTTACACAAGCAGAACAATTGATGCT[C/T]
CGTGGCCGTAAAATTGTCTCTCTTGTCTGATTCCTGCAATCTTTGGACATTCAATCCAGATCTGAAATTCTTGCTGTTTCTACACAAACAAGGAGTATAC
GTATACTCCTTGTTTGTGTAGAAACAGCAAGAATTTCAGATCTGGATTGAATGTCCAAAGATTGCAGGAATCAGACAAGAGAGACAATTTTACGGCCACG[G/A]
AGCATCAATTGTTCTGCTTGTGTAAAGATTTGAAAAAATTTTAGACAGGTTAATGATGTACAGGTACAGCAAGTCAGCAACAGTTATTACAGAAGTGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.60% | 37.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 93.80% | 6.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 99.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225940329 | C -> T | LOC_Os12g41870.1 | downstream_gene_variant ; 4190.0bp to feature; MODIFIER | silent_mutation | Average:44.892; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg1225940329 | C -> T | LOC_Os12g41860-LOC_Os12g41870 | intergenic_region ; MODIFIER | silent_mutation | Average:44.892; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225940329 | NA | 2.31E-40 | mr1105 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 4.06E-11 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 9.83E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 1.51E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 1.40E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 4.03E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 1.77E-30 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 1.62E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 4.08E-32 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 3.59E-18 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 9.11E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 3.03E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225940329 | NA | 5.12E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |