\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225863791:

Variant ID: vg1225863791 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25863791
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAAAAGCAGATTGGAGCGACAAACTCGTGGGGTCGAAGATTGATTTGATCAGAAGATGGCGCCAACAGCGGCGATGATATATTCCATCACACTTGTC[A/G]
ATAGAAAACTCAGCGCACCCCTATCTGGCGCGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAGGGGGTAGCACACGAGACCTAAAAGTGGATGGA

Reverse complement sequence

TCCATCCACTTTTAGGTCTCGTGTGCTACCCCCTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGCGCCAGATAGGGGTGCGCTGAGTTTTCTAT[T/C]
GACAAGTGTGATGGAATATATCATCGCCGCTGTTGGCGCCATCTTCTGATCAAATCAATCTTCGACCCCACGAGTTTGTCGCTCCAATCTGCTTTTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 3.40% 14.62% 47.74% NA
All Indica  2759 5.20% 3.70% 19.10% 71.98% NA
All Japonica  1512 92.90% 0.00% 0.60% 6.48% NA
Aus  269 0.40% 17.50% 37.17% 44.98% NA
Indica I  595 10.40% 0.00% 2.18% 87.39% NA
Indica II  465 3.70% 6.20% 29.89% 60.22% NA
Indica III  913 2.00% 4.20% 27.71% 66.16% NA
Indica Intermediate  786 5.90% 4.60% 15.52% 74.05% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 89.90% 0.00% 0.20% 9.92% NA
Japonica Intermediate  241 79.70% 0.00% 2.49% 17.84% NA
VI/Aromatic  96 21.90% 9.40% 41.67% 27.08% NA
Intermediate  90 53.30% 2.20% 16.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225863791 A -> DEL N N silent_mutation Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1225863791 A -> G LOC_Os12g41740.1 upstream_gene_variant ; 907.0bp to feature; MODIFIER silent_mutation Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1225863791 A -> G LOC_Os12g41750.1 downstream_gene_variant ; 3302.0bp to feature; MODIFIER silent_mutation Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1225863791 A -> G LOC_Os12g41740-LOC_Os12g41750 intergenic_region ; MODIFIER silent_mutation Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225863791 NA 2.07E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 1.70E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 3.84E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 8.32E-11 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 1.13E-17 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 3.90E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 1.68E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 5.47E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 8.48E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 6.08E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 1.84E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 3.79E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 7.24E-06 NA mr1525_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225863791 NA 5.43E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251