\
| Variant ID: vg1225863791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25863791 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 65. )
TAATAAAAGCAGATTGGAGCGACAAACTCGTGGGGTCGAAGATTGATTTGATCAGAAGATGGCGCCAACAGCGGCGATGATATATTCCATCACACTTGTC[A/G]
ATAGAAAACTCAGCGCACCCCTATCTGGCGCGCCAACTGTCGAAACATGAATTCGGCAATAATAAAAGGGGGTAGCACACGAGACCTAAAAGTGGATGGA
TCCATCCACTTTTAGGTCTCGTGTGCTACCCCCTTTTATTATTGCCGAATTCATGTTTCGACAGTTGGCGCGCCAGATAGGGGTGCGCTGAGTTTTCTAT[T/C]
GACAAGTGTGATGGAATATATCATCGCCGCTGTTGGCGCCATCTTCTGATCAAATCAATCTTCGACCCCACGAGTTTGTCGCTCCAATCTGCTTTTATTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.20% | 3.40% | 14.62% | 47.74% | NA |
| All Indica | 2759 | 5.20% | 3.70% | 19.10% | 71.98% | NA |
| All Japonica | 1512 | 92.90% | 0.00% | 0.60% | 6.48% | NA |
| Aus | 269 | 0.40% | 17.50% | 37.17% | 44.98% | NA |
| Indica I | 595 | 10.40% | 0.00% | 2.18% | 87.39% | NA |
| Indica II | 465 | 3.70% | 6.20% | 29.89% | 60.22% | NA |
| Indica III | 913 | 2.00% | 4.20% | 27.71% | 66.16% | NA |
| Indica Intermediate | 786 | 5.90% | 4.60% | 15.52% | 74.05% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 89.90% | 0.00% | 0.20% | 9.92% | NA |
| Japonica Intermediate | 241 | 79.70% | 0.00% | 2.49% | 17.84% | NA |
| VI/Aromatic | 96 | 21.90% | 9.40% | 41.67% | 27.08% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 16.67% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225863791 | A -> DEL | N | N | silent_mutation | Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1225863791 | A -> G | LOC_Os12g41740.1 | upstream_gene_variant ; 907.0bp to feature; MODIFIER | silent_mutation | Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1225863791 | A -> G | LOC_Os12g41750.1 | downstream_gene_variant ; 3302.0bp to feature; MODIFIER | silent_mutation | Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1225863791 | A -> G | LOC_Os12g41740-LOC_Os12g41750 | intergenic_region ; MODIFIER | silent_mutation | Average:26.017; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225863791 | NA | 2.07E-21 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 1.70E-14 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 3.84E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 8.32E-11 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 1.13E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 3.90E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 1.68E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 5.47E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 8.48E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 6.08E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 1.84E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 3.79E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | 7.24E-06 | NA | mr1525_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225863791 | NA | 5.43E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |