\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225855934:

Variant ID: vg1225855934 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25855934
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATTCACGAAATAAGACAAACGTCATATTTACAAACGAAAAGTAATTTGTGAGTAAAACTTTTACATAGCGATCTAAAAGCAAAGGCTAAAAACTAAA[C/T]
TTCAATGAAAAAAACCTCAAAATCAGCTCCAAATTTAAGATTGAAAATTTAAAGTTTGGCTGATAAGTATAAGAATAAGTGAAAAGACGGCACCCTAGCT

Reverse complement sequence

AGCTAGGGTGCCGTCTTTTCACTTATTCTTATACTTATCAGCCAAACTTTAAATTTTCAATCTTAAATTTGGAGCTGATTTTGAGGTTTTTTTCATTGAA[G/A]
TTTAGTTTTTAGCCTTTGCTTTTAGATCGCTATGTAAAAGTTTTACTCACAAATTACTTTTCGTTTGTAAATATGACGTTTGTCTTATTTCGTGAATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 0.20% 2.84% 62.76% NA
All Indica  2759 4.70% 0.30% 4.35% 90.65% NA
All Japonica  1512 92.90% 0.10% 0.53% 6.55% NA
Aus  269 3.00% 0.70% 0.74% 95.54% NA
Indica I  595 8.90% 0.30% 3.36% 87.39% NA
Indica II  465 3.20% 0.20% 6.02% 90.54% NA
Indica III  913 1.40% 0.00% 3.94% 94.63% NA
Indica Intermediate  786 6.20% 0.60% 4.58% 88.55% NA
Temperate Japonica  767 99.00% 0.00% 0.13% 0.91% NA
Tropical Japonica  504 89.90% 0.20% 0.99% 8.93% NA
Japonica Intermediate  241 79.70% 0.00% 0.83% 19.50% NA
VI/Aromatic  96 20.80% 0.00% 1.04% 78.12% NA
Intermediate  90 58.90% 0.00% 3.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225855934 C -> DEL N N silent_mutation Average:52.062; most accessible tissue: Callus, score: 93.919 N N N N
vg1225855934 C -> T LOC_Os12g41730.1 downstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:52.062; most accessible tissue: Callus, score: 93.919 N N N N
vg1225855934 C -> T LOC_Os12g41730-LOC_Os12g41740 intergenic_region ; MODIFIER silent_mutation Average:52.062; most accessible tissue: Callus, score: 93.919 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225855934 NA 1.00E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 1.43E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 4.04E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 2.53E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 2.88E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 1.32E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 2.33E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 5.66E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 6.79E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 1.29E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 3.41E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 5.40E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 3.19E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 4.86E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 5.53E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 9.69E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 2.99E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 1.60E-07 NA mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 8.43E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 6.16E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 7.57E-06 NA mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225855934 NA 2.02E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251