\
| Variant ID: vg1225855844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25855844 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.18, others allele: 0.00, population size: 90. )
ATTAATTAGTCCTAATGTTTTTATGTTAAGTAATTATTTATTGTTCCGAGCTACTTCAACTGCATACATTCTAGCGGACCCATCGTTTCGCTTATTCACG[A/G]
AATAAGACAAACGTCATATTTACAAACGAAAAGTAATTTGTGAGTAAAACTTTTACATAGCGATCTAAAAGCAAAGGCTAAAAACTAAACTTCAATGAAA
TTTCATTGAAGTTTAGTTTTTAGCCTTTGCTTTTAGATCGCTATGTAAAAGTTTTACTCACAAATTACTTTTCGTTTGTAAATATGACGTTTGTCTTATT[T/C]
CGTGAATAAGCGAAACGATGGGTCCGCTAGAATGTATGCAGTTGAAGTAGCTCGGAACAATAAATAATTACTTAACATAAAAACATTAGGACTAATTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 33.40% | 8.59% | 6.88% | NA |
| All Indica | 2759 | 72.20% | 3.80% | 13.37% | 10.62% | NA |
| All Japonica | 1512 | 7.00% | 92.80% | 0.20% | 0.00% | NA |
| Aus | 269 | 81.00% | 0.40% | 9.29% | 9.29% | NA |
| Indica I | 595 | 55.00% | 8.40% | 26.39% | 10.25% | NA |
| Indica II | 465 | 78.50% | 2.80% | 10.97% | 7.74% | NA |
| Indica III | 913 | 81.30% | 0.70% | 4.27% | 13.80% | NA |
| Indica Intermediate | 786 | 71.10% | 4.50% | 15.52% | 8.91% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 89.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.50% | 79.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 21.90% | 4.17% | 4.17% | NA |
| Intermediate | 90 | 36.70% | 54.40% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225855844 | A -> DEL | N | N | silent_mutation | Average:49.162; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg1225855844 | A -> G | LOC_Os12g41730.1 | downstream_gene_variant ; 3587.0bp to feature; MODIFIER | silent_mutation | Average:49.162; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| vg1225855844 | A -> G | LOC_Os12g41730-LOC_Os12g41740 | intergenic_region ; MODIFIER | silent_mutation | Average:49.162; most accessible tissue: Minghui63 root, score: 84.323 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225855844 | NA | 1.08E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 7.60E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 4.40E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.83E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 6.14E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.66E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 5.77E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 3.61E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 6.60E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.54E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.19E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 2.10E-14 | mr1924 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.22E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 1.04E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225855844 | NA | 9.21E-17 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |