\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225842925:

Variant ID: vg1225842925 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25842925
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGTGTTCCTAGCAACCATCCTATCCCAGTACTCGTATTCTATTGCTAATTGTTCTTTCGATGGTAGCTAGGTGATCGCGTCAACATGAAGCACCTATG[C/T]
TGACTTCGTTAATCTCTTAAGATATGCTCATATCTGTAGTGATTTTATCACTCTCAAGTCTTAACACTAAGATATGCTGGTCGGACAGTTTTTCGAAGAT

Reverse complement sequence

ATCTTCGAAAAACTGTCCGACCAGCATATCTTAGTGTTAAGACTTGAGAGTGATAAAATCACTACAGATATGAGCATATCTTAAGAGATTAACGAAGTCA[G/A]
CATAGGTGCTTCATGTTGACGCGATCACCTAGCTACCATCGAAAGAACAATTAGCAATAGAATACGAGTACTGGGATAGGATGGTTGCTAGGAACACTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.40% 0.00% 0.00% NA
All Indica  2759 96.20% 3.80% 0.00% 0.00% NA
All Japonica  1512 7.10% 92.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 9.90% 90.10% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225842925 C -> T LOC_Os12g41720.1 upstream_gene_variant ; 2446.0bp to feature; MODIFIER silent_mutation Average:59.677; most accessible tissue: Callus, score: 74.005 N N N N
vg1225842925 C -> T LOC_Os12g41730.1 upstream_gene_variant ; 3267.0bp to feature; MODIFIER silent_mutation Average:59.677; most accessible tissue: Callus, score: 74.005 N N N N
vg1225842925 C -> T LOC_Os12g41720-LOC_Os12g41730 intergenic_region ; MODIFIER silent_mutation Average:59.677; most accessible tissue: Callus, score: 74.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225842925 NA 7.14E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 7.83E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 1.87E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 3.03E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 2.20E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 2.06E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 4.46E-07 3.58E-07 mr1672 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 2.09E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 1.71E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 2.00E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 1.05E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 9.69E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225842925 NA 1.70E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251