\
| Variant ID: vg1225594396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25594396 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.24, others allele: 0.00, population size: 86. )
AGAAAAAAATCACAGCACACACATATGTGTAAGGATTTGTTCTCACAACCTCCATTTTACCGAAATAACATATTACAAAGAGATTTTTGAAAGTTACATA[T/C]
AAGTTACACTATAGTTACAGTGTAATTACATGTAAGTTACAGTGTAATTACACTACGATTGTACTGTAATTACATCTGTCAAATTTTTGGGAGAAAATTT
AAATTTTCTCCCAAAAATTTGACAGATGTAATTACAGTACAATCGTAGTGTAATTACACTGTAACTTACATGTAATTACACTGTAACTATAGTGTAACTT[A/G]
TATGTAACTTTCAAAAATCTCTTTGTAATATGTTATTTCGGTAAAATGGAGGTTGTGAGAACAAATCCTTACACATATGTGTGTGCTGTGATTTTTTTCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 33.60% | 0.89% | 8.17% | NA |
| All Indica | 2759 | 39.10% | 49.40% | 1.05% | 10.44% | NA |
| All Japonica | 1512 | 99.60% | 0.10% | 0.26% | 0.07% | NA |
| Aus | 269 | 0.70% | 68.40% | 1.49% | 29.37% | NA |
| Indica I | 595 | 85.90% | 13.30% | 0.34% | 0.50% | NA |
| Indica II | 465 | 12.30% | 78.90% | 1.08% | 7.74% | NA |
| Indica III | 913 | 26.00% | 50.60% | 1.42% | 22.02% | NA |
| Indica Intermediate | 786 | 35.00% | 57.80% | 1.15% | 6.11% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 72.90% | 15.60% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 58.90% | 27.80% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225594396 | T -> C | LOC_Os12g41270.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1225594396 | T -> DEL | N | N | silent_mutation | Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225594396 | NA | 3.28E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 7.19E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.04E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 3.08E-07 | mr1931 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.38E-07 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 5.94E-10 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.36E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 2.56E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 4.97E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 2.42E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.05E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 6.88E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.00E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 5.68E-06 | mr1733_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 2.19E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 9.50E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 6.68E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225594396 | NA | 1.65E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |