\
| Variant ID: vg1225407241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 25407241 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )
CTCAGTGGCGCCACCAGCCTGGATAAGCCGAAAGGGTGGGGGGAGAGAGGGGTTACGGTTAGGTAAACCCTAACCACCCTGCGGTTATTGCACAGTCGTC[G/A]
CCACCGTCACATCCACTGCCTTTCCACCACCGCTGCCGCCGTCGTTCCTCCTTCCTTCCTCCGTCGGCAGTTGGCAGGATAGATCTACGCCGATGACTCC
GGAGTCATCGGCGTAGATCTATCCTGCCAACTGCCGACGGAGGAAGGAAGGAGGAACGACGGCGGCAGCGGTGGTGGAAAGGCAGTGGATGTGACGGTGG[C/T]
GACGACTGTGCAATAACCGCAGGGTGGTTAGGGTTTACCTAACCGTAACCCCTCTCTCCCCCCACCCTTTCGGCTTATCCAGGCTGGTGGCGCCACTGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 3.40% | 0.76% | 3.17% | NA |
| All Indica | 2759 | 93.20% | 5.70% | 0.83% | 0.25% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 49.80% | 0.00% | 3.72% | 46.47% | NA |
| Indica I | 595 | 76.50% | 20.30% | 3.19% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.80% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 95.00% | 3.70% | 0.51% | 0.76% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 93.30% | 2.20% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1225407241 | G -> DEL | N | N | silent_mutation | Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg1225407241 | G -> A | LOC_Os12g41040.1 | upstream_gene_variant ; 3742.0bp to feature; MODIFIER | silent_mutation | Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg1225407241 | G -> A | LOC_Os12g41050.1 | upstream_gene_variant ; 579.0bp to feature; MODIFIER | silent_mutation | Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg1225407241 | G -> A | LOC_Os12g41040-LOC_Os12g41050 | intergenic_region ; MODIFIER | silent_mutation | Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1225407241 | NA | 8.36E-08 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1225407241 | NA | 2.57E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 6.86E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 5.24E-06 | mr1326 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 5.68E-10 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 2.49E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 9.72E-06 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 9.13E-13 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 4.56E-11 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 2.98E-11 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1225407241 | NA | 3.57E-10 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |