\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225407241:

Variant ID: vg1225407241 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25407241
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CTCAGTGGCGCCACCAGCCTGGATAAGCCGAAAGGGTGGGGGGAGAGAGGGGTTACGGTTAGGTAAACCCTAACCACCCTGCGGTTATTGCACAGTCGTC[G/A]
CCACCGTCACATCCACTGCCTTTCCACCACCGCTGCCGCCGTCGTTCCTCCTTCCTTCCTCCGTCGGCAGTTGGCAGGATAGATCTACGCCGATGACTCC

Reverse complement sequence

GGAGTCATCGGCGTAGATCTATCCTGCCAACTGCCGACGGAGGAAGGAAGGAGGAACGACGGCGGCAGCGGTGGTGGAAAGGCAGTGGATGTGACGGTGG[C/T]
GACGACTGTGCAATAACCGCAGGGTGGTTAGGGTTTACCTAACCGTAACCCCTCTCTCCCCCCACCCTTTCGGCTTATCCAGGCTGGTGGCGCCACTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 3.40% 0.76% 3.17% NA
All Indica  2759 93.20% 5.70% 0.83% 0.25% NA
All Japonica  1512 99.60% 0.20% 0.20% 0.00% NA
Aus  269 49.80% 0.00% 3.72% 46.47% NA
Indica I  595 76.50% 20.30% 3.19% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.00% 0.11% NA
Indica Intermediate  786 95.00% 3.70% 0.51% 0.76% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 93.30% 2.20% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225407241 G -> DEL N N silent_mutation Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1225407241 G -> A LOC_Os12g41040.1 upstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1225407241 G -> A LOC_Os12g41050.1 upstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg1225407241 G -> A LOC_Os12g41040-LOC_Os12g41050 intergenic_region ; MODIFIER silent_mutation Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225407241 NA 8.36E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1225407241 NA 2.57E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 6.86E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 5.24E-06 mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 5.68E-10 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 2.49E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 9.72E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 9.13E-13 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 4.56E-11 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 2.98E-11 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241 NA 3.57E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251