Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225227350:

Variant ID: vg1225227350 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 25227350
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGTCCCGGTTATTTTACACGGGACTAAAGATGGATATCTTTAGTTCCGGATTCATTGTACCGATTGTATAACCGGGAGTATATGGGGTTACCAACC[G/A]
GGAGTAAATCTCCTTTCTCCACCAGTGTAAAAAAACCGTCTCAATTGTCACTCTAGTTCGTGTATTCAGCTTGGTCCATAACCTATTTTATTAATTATAA

Reverse complement sequence

TTATAATTAATAAAATAGGTTATGGACCAAGCTGAATACACGAACTAGAGTGACAATTGAGACGGTTTTTTTACACTGGTGGAGAAAGGAGATTTACTCC[C/T]
GGTTGGTAACCCCATATACTCCCGGTTATACAATCGGTACAATGAATCCGGAACTAAAGATATCCATCTTTAGTCCCGTGTAAAATAACCGGGACTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	44.90%	0.78%	0.00%	NA
All Indica	2759	88.10%	11.50%	0.40%	0.00%	NA
All Japonica	1512	3.70%	95.00%	1.26%	0.00%	NA
Aus	269	1.50%	98.10%	0.37%	0.00%	NA
Indica I	595	98.20%	1.20%	0.67%	0.00%	NA
Indica II	465	94.40%	4.90%	0.65%	0.00%	NA
Indica III	913	80.30%	19.60%	0.11%	0.00%	NA
Indica Intermediate	786	85.80%	13.90%	0.38%	0.00%	NA
Temperate Japonica	767	1.00%	98.30%	0.65%	0.00%	NA
Tropical Japonica	504	6.50%	92.10%	1.39%	0.00%	NA
Japonica Intermediate	241	6.20%	90.90%	2.90%	0.00%	NA
VI/Aromatic	96	40.60%	53.10%	6.25%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225227350	G -> A	LOC_Os12g40730.1	upstream_gene_variant ; 1940.0bp to feature; MODIFIER	silent_mutation	Average:41.176; most accessible tissue: Callus, score: 78.714	N	N	N	N
vg1225227350	G -> A	LOC_Os12g40730-LOC_Os12g40750	intergenic_region ; MODIFIER	silent_mutation	Average:41.176; most accessible tissue: Callus, score: 78.714	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1225227350	NA	1.83E-14	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	1.42E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	8.63E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	1.62E-13	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	1.71E-24	mr1164_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	6.92E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	3.87E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	2.08E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	4.08E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	4.31E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	4.95E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225227350	NA	4.98E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251