\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225206470:

Variant ID: vg1225206470 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25206470
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.03, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTTTACAATGTAAGACTTTTTAGCATTGTCCACATTCATTTAGATGTTAATGAATCTATATATATATGTATGTGTTTAGATTCATTAACACCTATAT[G/T]
TATGTGGGCAATGCTAGAAAGTCTTACATTATAAAACGGAGGGAGTACCTTCGTCCCAGAATAATTGTAATTTTATGTTGTTTAGCCTATATTAAGGTTT

Reverse complement sequence

AAACCTTAATATAGGCTAAACAACATAAAATTACAATTATTCTGGGACGAAGGTACTCCCTCCGTTTTATAATGTAAGACTTTCTAGCATTGCCCACATA[C/A]
ATATAGGTGTTAATGAATCTAAACACATACATATATATATAGATTCATTAACATCTAAATGAATGTGGACAATGCTAAAAAGTCTTACATTGTAAAACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.40% 0.02% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 47.90% 52.10% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 9.30% 90.70% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 32.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225206470 G -> T LOC_Os12g40720.1 upstream_gene_variant ; 1088.0bp to feature; MODIFIER silent_mutation Average:38.743; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1225206470 G -> T LOC_Os12g40710.1 downstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:38.743; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1225206470 G -> T LOC_Os12g40710-LOC_Os12g40720 intergenic_region ; MODIFIER silent_mutation Average:38.743; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225206470 NA 4.98E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 2.95E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 7.64E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.38E-28 mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.59E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 2.33E-54 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.87E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.67E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.78E-25 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 6.57E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.47E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 6.32E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.48E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 7.30E-13 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.23E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.03E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 9.79E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 2.29E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 8.96E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 2.02E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.73E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.85E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.95E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 6.69E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.43E-28 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 6.93E-15 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 7.55E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.93E-34 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 8.73E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.74E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.52E-66 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.39E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.21E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.27E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.11E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 6.20E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 5.42E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.58E-47 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.80E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.58E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.86E-25 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 7.87E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.78E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 3.11E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.59E-33 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 5.38E-13 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.30E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.67E-41 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 1.02E-07 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225206470 NA 4.51E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251