\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225011564:

Variant ID: vg1225011564 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25011564
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, A: 0.19, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTCTAATTATCTGAAGAGATAAATGAATTAATTAAGTTACAAAGTGGACTTAAATTAATGTTTTAACAAATTCATCTATAAGGTTAAAGTTTTTTTT[A/T]
AAAAAAAGAAAGAATCATGTACTGTTTGAGAGTTTACAAAGTGTGCCGGTGAATTATTAATCCATTAAGAGGAAAATAACATGTCCTTAAGTTGATGGCC

Reverse complement sequence

GGCCATCAACTTAAGGACATGTTATTTTCCTCTTAATGGATTAATAATTCACCGGCACACTTTGTAAACTCTCAAACAGTACATGATTCTTTCTTTTTTT[T/A]
AAAAAAAACTTTAACCTTATAGATGAATTTGTTAAAACATTAATTTAAGTCCACTTTGTAACTTAATTAATTCATTTATCTCTTCAGATAATTAGAGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 26.40% 1.44% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 20.80% 75.50% 3.70% 0.00% NA
Aus  269 94.40% 3.00% 2.60% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 93.70% 1.83% 0.00% NA
Tropical Japonica  504 44.80% 51.40% 3.77% 0.00% NA
Japonica Intermediate  241 22.80% 67.60% 9.54% 0.00% NA
VI/Aromatic  96 90.60% 6.20% 3.12% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225011564 A -> T LOC_Os12g40390.1 upstream_gene_variant ; 4491.0bp to feature; MODIFIER silent_mutation Average:82.576; most accessible tissue: Zhenshan97 root, score: 96.857 N N N N
vg1225011564 A -> T LOC_Os12g40419.3 upstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:82.576; most accessible tissue: Zhenshan97 root, score: 96.857 N N N N
vg1225011564 A -> T LOC_Os12g40400.1 downstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:82.576; most accessible tissue: Zhenshan97 root, score: 96.857 N N N N
vg1225011564 A -> T LOC_Os12g40400-LOC_Os12g40419 intergenic_region ; MODIFIER silent_mutation Average:82.576; most accessible tissue: Zhenshan97 root, score: 96.857 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1225011564 A T -0.01 0.0 -0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1225011564 NA 1.02E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225011564 NA 6.89E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225011564 NA 1.32E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225011564 NA 1.17E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225011564 NA 1.54E-24 mr1689 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225011564 NA 2.00E-15 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251