Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224760684:

Variant ID: vg1224760684 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24760684
Reference Allele: G	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTCGCGGGATGCCCTGGAAGAACTTATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTTCTCTAGCCGACGCATCCA[G/A,C]
GCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACCGCCTATGCGGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGCTGCCTTGCGAG

Reverse complement sequence

CTCGCAAGGCAGCGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCCGCATAGGCGGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGC[C/T,G]
TGGATGCGTCGGCTAGAGAAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATAAGTTCTTCCAGGGCATCCCGCGAACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	39.30%	0.49%	0.00%	NA
All Indica	2759	89.00%	10.30%	0.72%	0.00%	NA
All Japonica	1512	22.40%	77.60%	0.07%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	88.10%	9.10%	2.86%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	85.70%	14.30%	0.00%	0.00%	NA
Indica Intermediate	786	88.00%	11.60%	0.38%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	56.90%	42.90%	0.20%	0.00%	NA
Japonica Intermediate	241	9.10%	90.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224760684	G -> C	LOC_Os12g40040.1	upstream_gene_variant ; 1881.0bp to feature; MODIFIER	N	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1224760684	G -> C	LOC_Os12g40050.1	upstream_gene_variant ; 16.0bp to feature; MODIFIER	N	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1224760684	G -> C	LOC_Os12g40040-LOC_Os12g40050	intergenic_region ; MODIFIER	N	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1224760684	G -> A	LOC_Os12g40040.1	upstream_gene_variant ; 1881.0bp to feature; MODIFIER	silent_mutation	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1224760684	G -> A	LOC_Os12g40050.1	upstream_gene_variant ; 16.0bp to feature; MODIFIER	silent_mutation	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N
vg1224760684	G -> A	LOC_Os12g40040-LOC_Os12g40050	intergenic_region ; MODIFIER	silent_mutation	Average:13.24; most accessible tissue: Zhenshan97 flag leaf, score: 23.298	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224760684	NA	3.54E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	3.38E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	1.97E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	3.18E-14	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	2.07E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	1.49E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	2.71E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	3.64E-08	7.05E-08	mr1218_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	2.94E-18	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	3.21E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	1.30E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	3.91E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	1.21E-13	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	1.75E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	5.43E-08	3.14E-07	mr1850_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	2.21E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	3.63E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224760684	NA	6.66E-09	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251