\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224751514:

Variant ID: vg1224751514 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24751514
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTTCAGAAGTTGGTGGACAAAGCTATCCGTCAGGAGGAGCAGGGTAACAAAATGAACCGAAAACGGAAGGCATCTCAGTTCAGAACTTTAACAGTCA[A/G]
AAGCCTCGCTTCATGATGGGACGTCAGGGTGGACCTTCCACCATGGTTATCCGGCAGCACCGTCCCTATCACCCGGGTAGCTTCAACAAGAACCACCATA

Reverse complement sequence

TATGGTGGTTCTTGTTGAAGCTACCCGGGTGATAGGGACGGTGCTGCCGGATAACCATGGTGGAAGGTCCACCCTGACGTCCCATCATGAAGCGAGGCTT[T/C]
TGACTGTTAAAGTTCTGAACTGAGATGCCTTCCGTTTTCGGTTCATTTTGTTACCCTGCTCCTCCTGACGGATAGCTTTGTCCACCAACTTCTGAAAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.20% 15.80% 4.85% 58.13% NA
All Indica  2759 10.90% 0.60% 3.73% 84.70% NA
All Japonica  1512 31.40% 47.20% 2.45% 18.92% NA
Aus  269 43.90% 0.00% 28.25% 27.88% NA
Indica I  595 4.00% 0.50% 2.52% 92.94% NA
Indica II  465 2.80% 1.30% 1.72% 94.19% NA
Indica III  913 19.10% 0.30% 6.13% 74.48% NA
Indica Intermediate  786 11.60% 0.60% 3.05% 84.73% NA
Temperate Japonica  767 13.80% 82.10% 0.91% 3.13% NA
Tropical Japonica  504 43.10% 3.80% 5.36% 47.82% NA
Japonica Intermediate  241 63.10% 27.00% 1.24% 8.71% NA
VI/Aromatic  96 92.70% 0.00% 4.17% 3.12% NA
Intermediate  90 20.00% 18.90% 10.00% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224751514 A -> DEL N N silent_mutation Average:9.858; most accessible tissue: Minghui63 flower, score: 14.782 N N N N
vg1224751514 A -> G LOC_Os12g40020.1 downstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:9.858; most accessible tissue: Minghui63 flower, score: 14.782 N N N N
vg1224751514 A -> G LOC_Os12g40040.1 downstream_gene_variant ; 4558.0bp to feature; MODIFIER silent_mutation Average:9.858; most accessible tissue: Minghui63 flower, score: 14.782 N N N N
vg1224751514 A -> G LOC_Os12g40010.2 downstream_gene_variant ; 4970.0bp to feature; MODIFIER silent_mutation Average:9.858; most accessible tissue: Minghui63 flower, score: 14.782 N N N N
vg1224751514 A -> G LOC_Os12g40030.1 intron_variant ; MODIFIER silent_mutation Average:9.858; most accessible tissue: Minghui63 flower, score: 14.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224751514 NA 3.96E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 4.30E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 1.28E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 5.81E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 6.49E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 9.00E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 5.54E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 7.93E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 8.40E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 9.38E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 4.36E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 2.23E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 2.80E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 3.06E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 1.65E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 3.48E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 1.45E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 1.61E-08 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 3.13E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 6.83E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 4.82E-11 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 3.32E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 1.40E-26 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 4.15E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 2.55E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 5.11E-08 mr1853_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 8.42E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224751514 NA 4.14E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251