\
| Variant ID: vg1224680553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24680553 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTAAATTGAAGTCTGAACAACCGCCCTTAACAGGCTCCTTGAATTTTCGGCGACAATCTCTCTCCTTCCTTAGAATACGAACCGTCAGATAGTGCGCC[A/T]
ATTTAAAGGGATTTTGGGATACATTTCGAGTCCGTTTGCCAAAAAATTCCCCAACCTTCCAGCAGCCTCGAATCCTTCGTCTCCCCAGAAAGCCCTAACC
GGTTAGGGCTTTCTGGGGAGACGAAGGATTCGAGGCTGCTGGAAGGTTGGGGAATTTTTTGGCAAACGGACTCGAAATGTATCCCAAAATCCCTTTAAAT[T/A]
GGCGCACTATCTGACGGTTCGTATTCTAAGGAAGGAGAGAGATTGTCGCCGAAAATTCAAGGAGCCTGTTAAGGGCGGTTGTTCAGACTTCAATTTAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.60% | 14.90% | 0.19% | 0.30% | NA |
| All Indica | 2759 | 99.30% | 0.20% | 0.00% | 0.51% | NA |
| All Japonica | 1512 | 54.20% | 45.30% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 0.10% | 0.00% | 1.42% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 21.10% | 78.40% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 25.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224680553 | A -> DEL | N | N | silent_mutation | Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1224680553 | A -> T | LOC_Os12g39940.1 | upstream_gene_variant ; 3760.0bp to feature; MODIFIER | silent_mutation | Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1224680553 | A -> T | LOC_Os12g39930.1 | downstream_gene_variant ; 1097.0bp to feature; MODIFIER | silent_mutation | Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1224680553 | A -> T | LOC_Os12g39920-LOC_Os12g39930 | intergenic_region ; MODIFIER | silent_mutation | Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224680553 | 6.15E-06 | NA | mr1318 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | 2.51E-06 | NA | mr1648 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 3.95E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | 5.97E-06 | 9.96E-08 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 6.32E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 1.47E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 1.03E-07 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 3.15E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 7.42E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 7.44E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224680553 | NA | 6.08E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |