Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224680553:

Variant ID: vg1224680553 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24680553
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTAAATTGAAGTCTGAACAACCGCCCTTAACAGGCTCCTTGAATTTTCGGCGACAATCTCTCTCCTTCCTTAGAATACGAACCGTCAGATAGTGCGCC[A/T]
ATTTAAAGGGATTTTGGGATACATTTCGAGTCCGTTTGCCAAAAAATTCCCCAACCTTCCAGCAGCCTCGAATCCTTCGTCTCCCCAGAAAGCCCTAACC

Reverse complement sequence

GGTTAGGGCTTTCTGGGGAGACGAAGGATTCGAGGCTGCTGGAAGGTTGGGGAATTTTTTGGCAAACGGACTCGAAATGTATCCCAAAATCCCTTTAAAT[T/A]
GGCGCACTATCTGACGGTTCGTATTCTAAGGAAGGAGAGAGATTGTCGCCGAAAATTCAAGGAGCCTGTTAAGGGCGGTTGTTCAGACTTCAATTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	14.90%	0.19%	0.30%	NA
All Indica	2759	99.30%	0.20%	0.00%	0.51%	NA
All Japonica	1512	54.20%	45.30%	0.53%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.50%	0.10%	0.00%	1.42%	NA
Indica Intermediate	786	99.50%	0.40%	0.00%	0.13%	NA
Temperate Japonica	767	21.10%	78.40%	0.52%	0.00%	NA
Tropical Japonica	504	95.00%	4.40%	0.60%	0.00%	NA
Japonica Intermediate	241	73.90%	25.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224680553	A -> DEL	N	N	silent_mutation	Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1224680553	A -> T	LOC_Os12g39940.1	upstream_gene_variant ; 3760.0bp to feature; MODIFIER	silent_mutation	Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1224680553	A -> T	LOC_Os12g39930.1	downstream_gene_variant ; 1097.0bp to feature; MODIFIER	silent_mutation	Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1224680553	A -> T	LOC_Os12g39920-LOC_Os12g39930	intergenic_region ; MODIFIER	silent_mutation	Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224680553	6.15E-06	NA	mr1318	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	2.51E-06	NA	mr1648	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	3.95E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	5.97E-06	9.96E-08	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	6.32E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	1.47E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	1.03E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	3.15E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	7.42E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	7.44E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553	NA	6.08E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251