\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224680553:

Variant ID: vg1224680553 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24680553
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAATTGAAGTCTGAACAACCGCCCTTAACAGGCTCCTTGAATTTTCGGCGACAATCTCTCTCCTTCCTTAGAATACGAACCGTCAGATAGTGCGCC[A/T]
ATTTAAAGGGATTTTGGGATACATTTCGAGTCCGTTTGCCAAAAAATTCCCCAACCTTCCAGCAGCCTCGAATCCTTCGTCTCCCCAGAAAGCCCTAACC

Reverse complement sequence

GGTTAGGGCTTTCTGGGGAGACGAAGGATTCGAGGCTGCTGGAAGGTTGGGGAATTTTTTGGCAAACGGACTCGAAATGTATCCCAAAATCCCTTTAAAT[T/A]
GGCGCACTATCTGACGGTTCGTATTCTAAGGAAGGAGAGAGATTGTCGCCGAAAATTCAAGGAGCCTGTTAAGGGCGGTTGTTCAGACTTCAATTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 14.90% 0.19% 0.30% NA
All Indica  2759 99.30% 0.20% 0.00% 0.51% NA
All Japonica  1512 54.20% 45.30% 0.53% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.50% 0.10% 0.00% 1.42% NA
Indica Intermediate  786 99.50% 0.40% 0.00% 0.13% NA
Temperate Japonica  767 21.10% 78.40% 0.52% 0.00% NA
Tropical Japonica  504 95.00% 4.40% 0.60% 0.00% NA
Japonica Intermediate  241 73.90% 25.70% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224680553 A -> DEL N N silent_mutation Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1224680553 A -> T LOC_Os12g39940.1 upstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1224680553 A -> T LOC_Os12g39930.1 downstream_gene_variant ; 1097.0bp to feature; MODIFIER silent_mutation Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1224680553 A -> T LOC_Os12g39920-LOC_Os12g39930 intergenic_region ; MODIFIER silent_mutation Average:48.988; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224680553 6.15E-06 NA mr1318 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 2.51E-06 NA mr1648 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 3.95E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 5.97E-06 9.96E-08 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 6.32E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 1.47E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 1.03E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 3.15E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 7.42E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 7.44E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224680553 NA 6.08E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251