\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224593986:

Variant ID: vg1224593986 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24593986
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGCTTCGCTAACGTTATTGACGATGTGGTCTAACATGACTTAGGTCTTGTCTAGTTCAAAAAAATTTTGCCCAAAAACGTCACATCGAATCTTTGGAC[T/A]
CATGCATAGAGCATTAAATATAAATAAAAAATAATTGCACAGTTTGCATGGAAATCGAGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATA

Reverse complement sequence

TATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCTCGATTTCCATGCAAACTGTGCAATTATTTTTTATTTATATTTAATGCTCTATGCATG[A/T]
GTCCAAAGATTCGATGTGACGTTTTTGGGCAAAATTTTTTTGAACTAGACAAGACCTAAGTCATGTTAGACCACATCGTCAATAACGTTAGCGAAGCGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 23.20% 0.23% 0.78% NA
All Indica  2759 99.70% 0.20% 0.04% 0.04% NA
All Japonica  1512 32.10% 66.10% 0.60% 1.19% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.00% 0.13% NA
Temperate Japonica  767 12.00% 87.20% 0.78% 0.00% NA
Tropical Japonica  504 65.90% 30.20% 0.60% 3.37% NA
Japonica Intermediate  241 25.30% 74.30% 0.00% 0.41% NA
VI/Aromatic  96 14.60% 66.70% 1.04% 17.71% NA
Intermediate  90 72.20% 26.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224593986 T -> DEL N N silent_mutation Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1224593986 T -> A LOC_Os12g39800.1 upstream_gene_variant ; 2887.0bp to feature; MODIFIER silent_mutation Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1224593986 T -> A LOC_Os12g39800-LOC_Os12g39810 intergenic_region ; MODIFIER silent_mutation Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224593986 NA 9.13E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 1.20E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 4.58E-06 NA mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 8.62E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 8.77E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 3.98E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 3.22E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 3.90E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224593986 NA 4.97E-17 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251