\
| Variant ID: vg1224593986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24593986 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 73. )
TTCGCTTCGCTAACGTTATTGACGATGTGGTCTAACATGACTTAGGTCTTGTCTAGTTCAAAAAAATTTTGCCCAAAAACGTCACATCGAATCTTTGGAC[T/A]
CATGCATAGAGCATTAAATATAAATAAAAAATAATTGCACAGTTTGCATGGAAATCGAGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATA
TATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCTCGATTTCCATGCAAACTGTGCAATTATTTTTTATTTATATTTAATGCTCTATGCATG[A/T]
GTCCAAAGATTCGATGTGACGTTTTTGGGCAAAATTTTTTTGAACTAGACAAGACCTAAGTCATGTTAGACCACATCGTCAATAACGTTAGCGAAGCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 23.20% | 0.23% | 0.78% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 32.10% | 66.10% | 0.60% | 1.19% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 12.00% | 87.20% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 65.90% | 30.20% | 0.60% | 3.37% | NA |
| Japonica Intermediate | 241 | 25.30% | 74.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 66.70% | 1.04% | 17.71% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224593986 | T -> DEL | N | N | silent_mutation | Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1224593986 | T -> A | LOC_Os12g39800.1 | upstream_gene_variant ; 2887.0bp to feature; MODIFIER | silent_mutation | Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg1224593986 | T -> A | LOC_Os12g39800-LOC_Os12g39810 | intergenic_region ; MODIFIER | silent_mutation | Average:39.827; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224593986 | NA | 9.13E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 1.20E-06 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | 4.58E-06 | NA | mr1219 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 8.62E-08 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 8.77E-07 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 3.98E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 3.22E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 3.90E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224593986 | NA | 4.97E-17 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |