\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224533879:

Variant ID: vg1224533879 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24533879
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, A: 0.31, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGATCATACCAATGTCCATGATTTTCGGACGACAATTAATATTATAAGTTGTACAGTGTAATGTGCTTTCTACAGTGATTTTATTATTTAATTGGGTT[T/A]
CACCCGTGTCCAAGATTTTCGGACGACGATTAATTCCAACAATTCTGCACTGTAACGAATTTTTCTACAGTGATCTTATTATTTCATGAACAATTGGATT

Reverse complement sequence

AATCCAATTGTTCATGAAATAATAAGATCACTGTAGAAAAATTCGTTACAGTGCAGAATTGTTGGAATTAATCGTCGTCCGAAAATCTTGGACACGGGTG[A/T]
AACCCAATTAAATAATAAAATCACTGTAGAAAGCACATTACACTGTACAACTTATAATATTAATTGTCGTCCGAAAATCATGGACATTGGTATGATCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 7.40% 5.18% 0.13% NA
All Indica  2759 89.60% 2.60% 7.61% 0.22% NA
All Japonica  1512 98.10% 0.00% 1.92% 0.00% NA
Aus  269 4.10% 95.50% 0.37% 0.00% NA
Indica I  595 68.40% 3.20% 27.39% 1.01% NA
Indica II  465 98.30% 0.60% 1.08% 0.00% NA
Indica III  913 97.90% 1.80% 0.33% 0.00% NA
Indica Intermediate  786 90.80% 4.20% 4.96% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 0.00% 5.36% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 84.40% 10.40% 5.21% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224533879 T -> DEL N N silent_mutation Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg1224533879 T -> A LOC_Os12g39710.1 downstream_gene_variant ; 3907.0bp to feature; MODIFIER silent_mutation Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg1224533879 T -> A LOC_Os12g39780.1 downstream_gene_variant ; 167.0bp to feature; MODIFIER silent_mutation Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg1224533879 T -> A LOC_Os12g39730.1 downstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N
vg1224533879 T -> A LOC_Os12g39780-LOC_Os12g39730 intergenic_region ; MODIFIER silent_mutation Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224533879 4.63E-06 1.72E-09 mr1004 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 1.57E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 6.83E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 2.70E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 2.61E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 2.02E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 1.28E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 4.92E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 9.36E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879 NA 1.28E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251