\
| Variant ID: vg1224533879 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24533879 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, A: 0.31, others allele: 0.00, population size: 72. )
TTGGATCATACCAATGTCCATGATTTTCGGACGACAATTAATATTATAAGTTGTACAGTGTAATGTGCTTTCTACAGTGATTTTATTATTTAATTGGGTT[T/A]
CACCCGTGTCCAAGATTTTCGGACGACGATTAATTCCAACAATTCTGCACTGTAACGAATTTTTCTACAGTGATCTTATTATTTCATGAACAATTGGATT
AATCCAATTGTTCATGAAATAATAAGATCACTGTAGAAAAATTCGTTACAGTGCAGAATTGTTGGAATTAATCGTCGTCCGAAAATCTTGGACACGGGTG[A/T]
AACCCAATTAAATAATAAAATCACTGTAGAAAGCACATTACACTGTACAACTTATAATATTAATTGTCGTCCGAAAATCATGGACATTGGTATGATCCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 7.40% | 5.18% | 0.13% | NA |
| All Indica | 2759 | 89.60% | 2.60% | 7.61% | 0.22% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 1.92% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 68.40% | 3.20% | 27.39% | 1.01% | NA |
| Indica II | 465 | 98.30% | 0.60% | 1.08% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.80% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 4.20% | 4.96% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 5.36% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 10.40% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224533879 | T -> DEL | N | N | silent_mutation | Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg1224533879 | T -> A | LOC_Os12g39710.1 | downstream_gene_variant ; 3907.0bp to feature; MODIFIER | silent_mutation | Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg1224533879 | T -> A | LOC_Os12g39780.1 | downstream_gene_variant ; 167.0bp to feature; MODIFIER | silent_mutation | Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg1224533879 | T -> A | LOC_Os12g39730.1 | downstream_gene_variant ; 969.0bp to feature; MODIFIER | silent_mutation | Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg1224533879 | T -> A | LOC_Os12g39780-LOC_Os12g39730 | intergenic_region ; MODIFIER | silent_mutation | Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224533879 | 4.63E-06 | 1.72E-09 | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 1.57E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 6.83E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 2.70E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 2.61E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 2.02E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 1.28E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 4.92E-06 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 9.36E-06 | mr1857 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224533879 | NA | 1.28E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |