Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224533879:

Variant ID: vg1224533879 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24533879
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, A: 0.31, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGATCATACCAATGTCCATGATTTTCGGACGACAATTAATATTATAAGTTGTACAGTGTAATGTGCTTTCTACAGTGATTTTATTATTTAATTGGGTT[T/A]
CACCCGTGTCCAAGATTTTCGGACGACGATTAATTCCAACAATTCTGCACTGTAACGAATTTTTCTACAGTGATCTTATTATTTCATGAACAATTGGATT

Reverse complement sequence

AATCCAATTGTTCATGAAATAATAAGATCACTGTAGAAAAATTCGTTACAGTGCAGAATTGTTGGAATTAATCGTCGTCCGAAAATCTTGGACACGGGTG[A/T]
AACCCAATTAAATAATAAAATCACTGTAGAAAGCACATTACACTGTACAACTTATAATATTAATTGTCGTCCGAAAATCATGGACATTGGTATGATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	7.40%	5.18%	0.13%	NA
All Indica	2759	89.60%	2.60%	7.61%	0.22%	NA
All Japonica	1512	98.10%	0.00%	1.92%	0.00%	NA
Aus	269	4.10%	95.50%	0.37%	0.00%	NA
Indica I	595	68.40%	3.20%	27.39%	1.01%	NA
Indica II	465	98.30%	0.60%	1.08%	0.00%	NA
Indica III	913	97.90%	1.80%	0.33%	0.00%	NA
Indica Intermediate	786	90.80%	4.20%	4.96%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	0.00%	5.36%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	84.40%	10.40%	5.21%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224533879	T -> DEL	N	N	silent_mutation	Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1224533879	T -> A	LOC_Os12g39710.1	downstream_gene_variant ; 3907.0bp to feature; MODIFIER	silent_mutation	Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1224533879	T -> A	LOC_Os12g39780.1	downstream_gene_variant ; 167.0bp to feature; MODIFIER	silent_mutation	Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1224533879	T -> A	LOC_Os12g39730.1	downstream_gene_variant ; 969.0bp to feature; MODIFIER	silent_mutation	Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1224533879	T -> A	LOC_Os12g39780-LOC_Os12g39730	intergenic_region ; MODIFIER	silent_mutation	Average:41.984; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224533879	4.63E-06	1.72E-09	mr1004	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	1.57E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	6.83E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	2.70E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	2.61E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	2.02E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	1.28E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	4.92E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	9.36E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224533879	NA	1.28E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251