Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224524026:

Variant ID: vg1224524026 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24524026
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACACCAATGGAAGTTGCGGTGCGGGAGATTGCTACGCACTGGTTCGCGAACCAGCGAGTGAGTAGAATCATCTCTCGAACACCAATGAAGGCTTGCGGT[A/G]
CGGGAGATTGCTACGCACTTGTTCGAGACCCAGCGAGCAAGTAGAATCATCTCTCGAACACCAATGAAAGTTGCGGTGCGGGAGATTGCTACGCACTGGT

Reverse complement sequence

ACCAGTGCGTAGCAATCTCCCGCACCGCAACTTTCATTGGTGTTCGAGAGATGATTCTACTTGCTCGCTGGGTCTCGAACAAGTGCGTAGCAATCTCCCG[T/C]
ACCGCAAGCCTTCATTGGTGTTCGAGAGATGATTCTACTCACTCGCTGGTTCGCGAACCAGTGCGTAGCAATCTCCCGCACCGCAACTTCCATTGGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.80%	0.10%	0.63%	67.50%	NA
All Indica	2759	2.80%	0.00%	0.43%	96.74%	NA
All Japonica	1512	86.30%	0.30%	0.86%	12.50%	NA
Aus	269	2.20%	0.00%	0.37%	97.40%	NA
Indica I	595	1.00%	0.00%	0.34%	98.66%	NA
Indica II	465	6.00%	0.00%	0.86%	93.12%	NA
Indica III	913	1.30%	0.00%	0.11%	98.58%	NA
Indica Intermediate	786	4.10%	0.00%	0.64%	95.29%	NA
Temperate Japonica	767	98.00%	0.00%	0.00%	1.96%	NA
Tropical Japonica	504	79.00%	1.00%	2.38%	17.66%	NA
Japonica Intermediate	241	64.30%	0.00%	0.41%	35.27%	NA
VI/Aromatic	96	62.50%	0.00%	1.04%	36.46%	NA
Intermediate	90	57.80%	0.00%	3.33%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224524026	A -> DEL	N	N	silent_mutation	Average:17.821; most accessible tissue: Callus, score: 64.248	N	N	N	N
vg1224524026	A -> G	LOC_Os12g39710.1	upstream_gene_variant ; 2638.0bp to feature; MODIFIER	silent_mutation	Average:17.821; most accessible tissue: Callus, score: 64.248	N	N	N	N
vg1224524026	A -> G	LOC_Os12g39700.1	intron_variant ; MODIFIER	silent_mutation	Average:17.821; most accessible tissue: Callus, score: 64.248	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224524026	NA	2.34E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.59E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.71E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	5.84E-29	mr1256	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	6.62E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.01E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	4.42E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	3.91E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	2.09E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	5.28E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.70E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	6.00E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	5.28E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	5.54E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.25E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	4.86E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	3.49E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	6.00E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	4.37E-06	3.02E-06	mr1574	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	8.56E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	2.47E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.46E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	6.58E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	1.80E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	2.65E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026	NA	8.56E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251