\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224524026:

Variant ID: vg1224524026 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24524026
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACACCAATGGAAGTTGCGGTGCGGGAGATTGCTACGCACTGGTTCGCGAACCAGCGAGTGAGTAGAATCATCTCTCGAACACCAATGAAGGCTTGCGGT[A/G]
CGGGAGATTGCTACGCACTTGTTCGAGACCCAGCGAGCAAGTAGAATCATCTCTCGAACACCAATGAAAGTTGCGGTGCGGGAGATTGCTACGCACTGGT

Reverse complement sequence

ACCAGTGCGTAGCAATCTCCCGCACCGCAACTTTCATTGGTGTTCGAGAGATGATTCTACTTGCTCGCTGGGTCTCGAACAAGTGCGTAGCAATCTCCCG[T/C]
ACCGCAAGCCTTCATTGGTGTTCGAGAGATGATTCTACTCACTCGCTGGTTCGCGAACCAGTGCGTAGCAATCTCCCGCACCGCAACTTCCATTGGTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.80% 0.10% 0.63% 67.50% NA
All Indica  2759 2.80% 0.00% 0.43% 96.74% NA
All Japonica  1512 86.30% 0.30% 0.86% 12.50% NA
Aus  269 2.20% 0.00% 0.37% 97.40% NA
Indica I  595 1.00% 0.00% 0.34% 98.66% NA
Indica II  465 6.00% 0.00% 0.86% 93.12% NA
Indica III  913 1.30% 0.00% 0.11% 98.58% NA
Indica Intermediate  786 4.10% 0.00% 0.64% 95.29% NA
Temperate Japonica  767 98.00% 0.00% 0.00% 1.96% NA
Tropical Japonica  504 79.00% 1.00% 2.38% 17.66% NA
Japonica Intermediate  241 64.30% 0.00% 0.41% 35.27% NA
VI/Aromatic  96 62.50% 0.00% 1.04% 36.46% NA
Intermediate  90 57.80% 0.00% 3.33% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224524026 A -> DEL N N silent_mutation Average:17.821; most accessible tissue: Callus, score: 64.248 N N N N
vg1224524026 A -> G LOC_Os12g39710.1 upstream_gene_variant ; 2638.0bp to feature; MODIFIER silent_mutation Average:17.821; most accessible tissue: Callus, score: 64.248 N N N N
vg1224524026 A -> G LOC_Os12g39700.1 intron_variant ; MODIFIER silent_mutation Average:17.821; most accessible tissue: Callus, score: 64.248 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224524026 NA 2.34E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.59E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.71E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 5.84E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 6.62E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.01E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 4.42E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 3.91E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 2.09E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 5.28E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.70E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 6.00E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 5.28E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 5.54E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.25E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 4.86E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 3.49E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 6.00E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 4.37E-06 3.02E-06 mr1574 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 8.56E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 2.47E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.46E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 6.58E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 1.80E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 2.65E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224524026 NA 8.56E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251