\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224515996:

Variant ID: vg1224515996 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24515996
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCTCCTTGAATGCCTTTGTAAAACATAAGACCCATGTTCTCAAAAGAATACTGCTTCTGGGTGTCAACTCTGGGAAGAATCTTCCATCATACAAGGCG[G/T]
TTTTTTTCACAAGACTATTCTTGTGCTTGTGTAAATATTCCTCCAGTGATGTACCAGCACCCCCCAGAATTCTACTGCGAACATTCACAGTACTGTCTTT

Reverse complement sequence

AAAGACAGTACTGTGAATGTTCGCAGTAGAATTCTGGGGGGTGCTGGTACATCACTGGAGGAATATTTACACAAGCACAAGAATAGTCTTGTGAAAAAAA[C/A]
CGCCTTGTATGATGGAAGATTCTTCCCAGAGTTGACACCCAGAAGCAGTATTCTTTTGAGAACATGGGTCTTATGTTTTACAAAGGCATTCAAGGAGCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 4.30% 2.41% 62.04% NA
All Indica  2759 3.80% 0.00% 1.56% 94.64% NA
All Japonica  1512 81.90% 12.80% 4.43% 0.86% NA
Aus  269 2.20% 0.00% 0.74% 97.03% NA
Indica I  595 3.50% 0.00% 3.87% 92.61% NA
Indica II  465 7.30% 0.00% 0.43% 92.26% NA
Indica III  913 1.80% 0.00% 0.66% 97.59% NA
Indica Intermediate  786 4.20% 0.10% 1.53% 94.15% NA
Temperate Japonica  767 72.50% 19.20% 7.17% 1.17% NA
Tropical Japonica  504 98.60% 0.60% 0.40% 0.40% NA
Japonica Intermediate  241 77.20% 17.80% 4.15% 0.83% NA
VI/Aromatic  96 81.20% 6.20% 0.00% 12.50% NA
Intermediate  90 56.70% 2.20% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224515996 G -> DEL LOC_Os12g39700.1 N frameshift_variant Average:12.221; most accessible tissue: Callus, score: 79.731 N N N N
vg1224515996 G -> T LOC_Os12g39700.1 missense_variant ; p.Thr1296Asn; MODERATE nonsynonymous_codon ; T1296N Average:12.221; most accessible tissue: Callus, score: 79.731 unknown unknown DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224515996 NA 9.14E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996 NA 1.82E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996 NA 6.93E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996 NA 1.91E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 4.25E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 6.61E-06 6.60E-06 mr1099 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 5.64E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 3.39E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 5.74E-06 3.80E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 3.83E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 5.53E-08 2.29E-08 mr1318 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 9.98E-06 1.92E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 7.69E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 9.92E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 8.91E-12 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 1.22E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 9.39E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 2.44E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 2.46E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 7.22E-06 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 6.18E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996 NA 8.93E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251