Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224515996:

Variant ID: vg1224515996 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24515996
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCTCCTTGAATGCCTTTGTAAAACATAAGACCCATGTTCTCAAAAGAATACTGCTTCTGGGTGTCAACTCTGGGAAGAATCTTCCATCATACAAGGCG[G/T]
TTTTTTTCACAAGACTATTCTTGTGCTTGTGTAAATATTCCTCCAGTGATGTACCAGCACCCCCCAGAATTCTACTGCGAACATTCACAGTACTGTCTTT

Reverse complement sequence

AAAGACAGTACTGTGAATGTTCGCAGTAGAATTCTGGGGGGTGCTGGTACATCACTGGAGGAATATTTACACAAGCACAAGAATAGTCTTGTGAAAAAAA[C/A]
CGCCTTGTATGATGGAAGATTCTTCCCAGAGTTGACACCCAGAAGCAGTATTCTTTTGAGAACATGGGTCTTATGTTTTACAAAGGCATTCAAGGAGCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.30%	4.30%	2.41%	62.04%	NA
All Indica	2759	3.80%	0.00%	1.56%	94.64%	NA
All Japonica	1512	81.90%	12.80%	4.43%	0.86%	NA
Aus	269	2.20%	0.00%	0.74%	97.03%	NA
Indica I	595	3.50%	0.00%	3.87%	92.61%	NA
Indica II	465	7.30%	0.00%	0.43%	92.26%	NA
Indica III	913	1.80%	0.00%	0.66%	97.59%	NA
Indica Intermediate	786	4.20%	0.10%	1.53%	94.15%	NA
Temperate Japonica	767	72.50%	19.20%	7.17%	1.17%	NA
Tropical Japonica	504	98.60%	0.60%	0.40%	0.40%	NA
Japonica Intermediate	241	77.20%	17.80%	4.15%	0.83%	NA
VI/Aromatic	96	81.20%	6.20%	0.00%	12.50%	NA
Intermediate	90	56.70%	2.20%	2.22%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224515996	G -> DEL	LOC_Os12g39700.1	N	frameshift_variant	Average:12.221; most accessible tissue: Callus, score: 79.731	N	N	N	N
vg1224515996	G -> T	LOC_Os12g39700.1	missense_variant ; p.Thr1296Asn; MODERATE	nonsynonymous_codon ; T1296N	Average:12.221; most accessible tissue: Callus, score: 79.731	unknown	unknown	DELETERIOUS	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224515996	NA	9.14E-18	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996	NA	1.82E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996	NA	6.93E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1224515996	NA	1.91E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	4.25E-06	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	6.61E-06	6.60E-06	mr1099	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	5.64E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	3.39E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	5.74E-06	3.80E-06	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	3.83E-07	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	5.53E-08	2.29E-08	mr1318	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	9.98E-06	1.92E-07	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	7.69E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	9.92E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	8.91E-12	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	1.22E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	9.39E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	2.44E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	2.46E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	7.22E-06	mr1887	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	6.18E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224515996	NA	8.93E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251