\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224504289:

Variant ID: vg1224504289 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24504289
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGATCCAAGACTCAGGGTGATCCCCATCAAACACCGGAAAATCCACATGCTTATGATTACGATTAAAAGGGTCACCATATTGAGGTCTTTTTCTGTAA[C/T]
TGTGATCAACAGAATCATAACGAGTCTCCTCCTGTCTGTGCCAGAATGGTGGTCCACGATCAAGAGGTCGGTGGAAATCAAAGGAGGGTGGGGGTGGAGG

Reverse complement sequence

CCTCCACCCCCACCCTCCTTTGATTTCCACCGACCTCTTGATCGTGGACCACCATTCTGGCACAGACAGGAGGAGACTCGTTATGATTCTGTTGATCACA[G/A]
TTACAGAAAAAGACCTCAATATGGTGACCCTTTTAATCGTAATCATAAGCATGTGGATTTTCCGGTGTTTGATGGGGATCACCCTGAGTCTTGGATCTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 13.60% 1.16% 12.57% NA
All Indica  2759 88.00% 0.40% 0.22% 11.42% NA
All Japonica  1512 56.60% 40.40% 2.91% 0.07% NA
Aus  269 3.00% 0.40% 0.37% 96.28% NA
Indica I  595 63.20% 0.20% 0.50% 36.13% NA
Indica II  465 97.40% 1.30% 0.00% 1.29% NA
Indica III  913 97.90% 0.10% 0.00% 1.97% NA
Indica Intermediate  786 89.60% 0.40% 0.38% 9.67% NA
Temperate Japonica  767 29.10% 67.30% 3.65% 0.00% NA
Tropical Japonica  504 88.70% 9.50% 1.79% 0.00% NA
Japonica Intermediate  241 77.20% 19.50% 2.90% 0.41% NA
VI/Aromatic  96 87.50% 0.00% 2.08% 10.42% NA
Intermediate  90 67.80% 20.00% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224504289 C -> DEL LOC_Os12g39680.1 N frameshift_variant Average:49.474; most accessible tissue: Minghui63 flower, score: 85.291 N N N N
vg1224504289 C -> T LOC_Os12g39680.1 missense_variant ; p.Ser211Asn; MODERATE nonsynonymous_codon ; S211N Average:49.474; most accessible tissue: Minghui63 flower, score: 85.291 unknown unknown TOLERATED 0.05

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1224504289 C T -0.04 -0.02 -0.02 -0.06 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224504289 NA 5.04E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224504289 NA 1.77E-06 mr1888 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224504289 NA 2.10E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224504289 NA 8.58E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224504289 NA 1.09E-06 mr1383_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224504289 NA 2.12E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251