Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224439207:

Variant ID: vg1224439207 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24439207
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGCGAAAATAAAACATGGTGCATCGAGTAGATGCACCTAATTAGGTGTAGCCCCCGACTATGTGATTAGTTGAAAAACTAAACATATAGTCAAGAA[C/T,A]
CAAGTGGTTTTATAGCGAAGCACGCATGGTACTTAGTAAGATACCCAGCCACCTGCTTCTCAACTTGAACACACCAAGGACAAAAAATACAAGAAGGGCC

Reverse complement sequence

GGCCCTTCTTGTATTTTTTGTCCTTGGTGTGTTCAAGTTGAGAAGCAGGTGGCTGGGTATCTTACTAAGTACCATGCGTGCTTCGCTATAAAACCACTTG[G/A,T]
TTCTTGACTATATGTTTAGTTTTTCAACTAATCACATAGTCGGGGGCTACACCTAATTAGGTGCATCTACTCGATGCACCATGTTTTATTTTCGCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.90% 0.23% 0.00% NA
All Indica  2759 91.30% 8.30% 0.40% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.20% 30.30% 1.51% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.50% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224439207 C -> A LOC_Os12g39600.1 upstream_gene_variant ; 801.0bp to feature; MODIFIER N Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg1224439207 C -> A LOC_Os12g39610.1 downstream_gene_variant ; 4563.0bp to feature; MODIFIER N Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg1224439207 C -> A LOC_Os12g39590-LOC_Os12g39600 intergenic_region ; MODIFIER N Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg1224439207 C -> T LOC_Os12g39600.1 upstream_gene_variant ; 801.0bp to feature; MODIFIER silent_mutation Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg1224439207 C -> T LOC_Os12g39610.1 downstream_gene_variant ; 4563.0bp to feature; MODIFIER silent_mutation Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg1224439207 C -> T LOC_Os12g39590-LOC_Os12g39600 intergenic_region ; MODIFIER silent_mutation Average:50.289; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1224439207 C A -0.03 0.0 0.0 -0.02 -0.01 0.0
vg1224439207 C T 0.01 0.01 0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224439207 NA 3.46E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 5.20E-06 NA mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 7.58E-06 mr1136_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 1.38E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 4.31E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 4.37E-07 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 5.89E-06 mr1266_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 1.23E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 4.00E-07 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 2.28E-06 5.91E-07 mr1711_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 1.16E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224439207 NA 6.95E-07 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251