\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224363975:

Variant ID: vg1224363975 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24363975
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTAAAATTTATATTTATTGATATTATATATATATTATAATAGAAAATGGTGGTCAAATTTATTTTTCGAAGACCGCGTCCTTATTCAAAACCATTA[G/A]
TATTATCAGCTCTTCGGGAGTAGTAGCCAATAGCTAAAAATATCACAAGAAACAAGGTCGAACCTTGATAGACCTAAGGACGTCATCCCATGGCCTAGAA

Reverse complement sequence

TTCTAGGCCATGGGATGACGTCCTTAGGTCTATCAAGGTTCGACCTTGTTTCTTGTGATATTTTTAGCTATTGGCTACTACTCCCGAAGAGCTGATAATA[C/T]
TAATGGTTTTGAATAAGGACGCGGTCTTCGAAAAATAAATTTGACCACCATTTTCTATTATAATATATATATAATATCAATAAATATAAATTTTACTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.90% 0.59% 0.00% NA
All Indica  2759 99.80% 0.00% 0.18% 0.00% NA
All Japonica  1512 92.60% 6.00% 1.39% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 86.70% 11.00% 2.35% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 2.90% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224363975 G -> A LOC_Os12g39520.1 upstream_gene_variant ; 3382.0bp to feature; MODIFIER silent_mutation Average:52.866; most accessible tissue: Callus, score: 82.912 N N N N
vg1224363975 G -> A LOC_Os12g39530.1 downstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:52.866; most accessible tissue: Callus, score: 82.912 N N N N
vg1224363975 G -> A LOC_Os12g39540.1 downstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:52.866; most accessible tissue: Callus, score: 82.912 N N N N
vg1224363975 G -> A LOC_Os12g39530-LOC_Os12g39540 intergenic_region ; MODIFIER silent_mutation Average:52.866; most accessible tissue: Callus, score: 82.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224363975 NA 5.39E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224363975 NA 2.63E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224363975 NA 2.12E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224363975 2.24E-06 2.24E-06 mr1967 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251