\
| Variant ID: vg1224363975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24363975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAGTAAAATTTATATTTATTGATATTATATATATATTATAATAGAAAATGGTGGTCAAATTTATTTTTCGAAGACCGCGTCCTTATTCAAAACCATTA[G/A]
TATTATCAGCTCTTCGGGAGTAGTAGCCAATAGCTAAAAATATCACAAGAAACAAGGTCGAACCTTGATAGACCTAAGGACGTCATCCCATGGCCTAGAA
TTCTAGGCCATGGGATGACGTCCTTAGGTCTATCAAGGTTCGACCTTGTTTCTTGTGATATTTTTAGCTATTGGCTACTACTCCCGAAGAGCTGATAATA[C/T]
TAATGGTTTTGAATAAGGACGCGGTCTTCGAAAAATAAATTTGACCACCATTTTCTATTATAATATATATATAATATCAATAAATATAAATTTTACTAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.90% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 92.60% | 6.00% | 1.39% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 86.70% | 11.00% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224363975 | G -> A | LOC_Os12g39520.1 | upstream_gene_variant ; 3382.0bp to feature; MODIFIER | silent_mutation | Average:52.866; most accessible tissue: Callus, score: 82.912 | N | N | N | N |
| vg1224363975 | G -> A | LOC_Os12g39530.1 | downstream_gene_variant ; 201.0bp to feature; MODIFIER | silent_mutation | Average:52.866; most accessible tissue: Callus, score: 82.912 | N | N | N | N |
| vg1224363975 | G -> A | LOC_Os12g39540.1 | downstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:52.866; most accessible tissue: Callus, score: 82.912 | N | N | N | N |
| vg1224363975 | G -> A | LOC_Os12g39530-LOC_Os12g39540 | intergenic_region ; MODIFIER | silent_mutation | Average:52.866; most accessible tissue: Callus, score: 82.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224363975 | NA | 5.39E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224363975 | NA | 2.63E-07 | mr1741 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224363975 | NA | 2.12E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224363975 | 2.24E-06 | 2.24E-06 | mr1967 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |