Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224334241:

Variant ID: vg1224334241 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24334241
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAATTTATTTATATGTTAGTTTATATGGAGGGGTTTAATATATTAAATTTCAATCCCTAAATGCAATTAGGAACTTGGTGTAATATCGATCTACATAT[C/T]
GAATTAATACTCCCATAATTCTATTATATATACAGAGAGCTCAATTTATTTGAATAATCATCATTTCATGTGTACTCATATTATGGCACCCACCTACATT

Reverse complement sequence

AATGTAGGTGGGTGCCATAATATGAGTACACATGAAATGATGATTATTCAAATAAATTGAGCTCTCTGTATATATAATAGAATTATGGGAGTATTAATTC[G/A]
ATATGTAGATCGATATTACACCAAGTTCCTAATTGCATTTAGGGATTGAAATTTAATATATTAAACCCCTCCATATAAACTAACATATAAATAAATTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	2.50%	13.97%	23.74%	NA
All Indica	2759	45.80%	0.60%	14.82%	38.78%	NA
All Japonica	1512	92.70%	6.20%	0.73%	0.40%	NA
Aus	269	5.20%	0.00%	83.27%	11.52%	NA
Indica I	595	37.50%	0.00%	21.34%	41.18%	NA
Indica II	465	46.20%	1.70%	6.88%	45.16%	NA
Indica III	913	59.80%	0.00%	13.14%	27.05%	NA
Indica Intermediate	786	35.50%	1.10%	16.54%	46.82%	NA
Temperate Japonica	767	98.70%	0.30%	0.26%	0.78%	NA
Tropical Japonica	504	80.80%	17.90%	1.39%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.83%	0.00%	NA
VI/Aromatic	96	89.60%	0.00%	7.29%	3.12%	NA
Intermediate	90	71.10%	5.60%	10.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224334241	C -> DEL	N	N	silent_mutation	Average:17.523; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1224334241	C -> T	LOC_Os12g39490.1	upstream_gene_variant ; 3476.0bp to feature; MODIFIER	silent_mutation	Average:17.523; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1224334241	C -> T	LOC_Os12g39480.1	downstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:17.523; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1224334241	C -> T	LOC_Os12g39480-LOC_Os12g39490	intergenic_region ; MODIFIER	silent_mutation	Average:17.523; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224334241	9.33E-06	1.91E-10	mr1217	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	8.98E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	6.25E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	1.05E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	8.67E-09	mr1845	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	2.57E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	1.78E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224334241	NA	8.52E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251