\
| Variant ID: vg1224308470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24308470 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )
ACAGTGAAGCTTAATCTATACTACTTTAAATATTAATAGTGGTGGCTGCAGTAAATCTACCATCACCATCCTCTTACTGATGTGTGGGCTCACAATGTGT[A/G]
TGTCAAAGAAACATAGCTCTATGTCTCATGACTCTGGCTAACTAGGTAAGAATCGAAAATATTTATGACAAAAAATGATTGGAGAGCTAAATATTTTTAG
CTAAAAATATTTAGCTCTCCAATCATTTTTTGTCATAAATATTTTCGATTCTTACCTAGTTAGCCAGAGTCATGAGACATAGAGCTATGTTTCTTTGACA[T/C]
ACACATTGTGAGCCCACACATCAGTAAGAGGATGGTGATGGTAGATTTACTGCAGCCACCACTATTAATATTTAAAGTAGTATAGATTAAGCTTCACTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 5.40% | 1.23% | 22.70% | NA |
| All Indica | 2759 | 50.60% | 9.20% | 2.07% | 38.17% | NA |
| All Japonica | 1512 | 99.40% | 0.10% | 0.00% | 0.53% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 37.50% | 33.10% | 0.67% | 28.74% | NA |
| Indica II | 465 | 51.00% | 1.10% | 1.29% | 46.67% | NA |
| Indica III | 913 | 67.00% | 0.10% | 1.86% | 31.00% | NA |
| Indica Intermediate | 786 | 41.10% | 6.50% | 3.82% | 48.60% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224308470 | A -> DEL | N | N | silent_mutation | Average:40.139; most accessible tissue: Callus, score: 70.182 | N | N | N | N |
| vg1224308470 | A -> G | LOC_Os12g39440-LOC_Os12g39450 | intergenic_region ; MODIFIER | silent_mutation | Average:40.139; most accessible tissue: Callus, score: 70.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224308470 | NA | 6.93E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 3.57E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 1.22E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 1.30E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 1.01E-08 | mr1571 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 3.98E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 6.37E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 2.14E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 1.77E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 3.46E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 1.54E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 2.06E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 6.88E-07 | mr1571_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224308470 | NA | 3.59E-06 | mr1637_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |