Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224247892:

Variant ID: vg1224247892 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24247892
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAGCATAACTCCTGTTTCACTCCCCTGCTAATATTTGAAGAGATTATGGTGTCTACTGGTGCACACTATTGATGTTTTCCAGAGAGTTGTAGCTACT[A/G]
TTATTTTTTATAGACTAGTAAAAGGAATTGGTGGTGGTGATGATTTGCTTTACACCCCACTACTTCATCAGATCTTTAGTGAATGGATCTATGTAGACAT

Reverse complement sequence

ATGTCTACATAGATCCATTCACTAAAGATCTGATGAAGTAGTGGGGTGTAAAGCAAATCATCACCACCACCAATTCCTTTTACTAGTCTATAAAAAATAA[T/C]
AGTAGCTACAACTCTCTGGAAAACATCAATAGTGTGCACCAGTAGACACCATAATCTCTTCAAATATTAGCAGGGGAGTGAAACAGGAGTTATGCTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	34.60%	2.33%	0.00%	NA
All Indica	2759	57.60%	40.80%	1.59%	0.00%	NA
All Japonica	1512	69.40%	26.70%	3.90%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	68.40%	27.20%	4.37%	0.00%	NA
Indica II	465	55.90%	42.80%	1.29%	0.00%	NA
Indica III	913	43.20%	56.60%	0.22%	0.00%	NA
Indica Intermediate	786	67.20%	31.60%	1.27%	0.00%	NA
Temperate Japonica	767	90.20%	5.70%	4.04%	0.00%	NA
Tropical Japonica	504	39.50%	57.50%	2.98%	0.00%	NA
Japonica Intermediate	241	65.60%	29.00%	5.39%	0.00%	NA
VI/Aromatic	96	20.80%	77.10%	2.08%	0.00%	NA
Intermediate	90	63.30%	31.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224247892	A -> G	LOC_Os12g39410.1	upstream_gene_variant ; 3011.0bp to feature; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.1	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.10	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.11	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.4	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.5	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.9	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.7	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.3	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.6	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.2	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N
vg1224247892	A -> G	LOC_Os12g39420.8	intron_variant ; MODIFIER	silent_mutation	Average:80.307; most accessible tissue: Callus, score: 92.559	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1224247892	A	G	-0.1	-0.03	-0.04	-0.01	-0.03	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224247892	NA	1.07E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	3.42E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	3.50E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	4.36E-06	1.44E-08	mr1112_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	4.84E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	4.89E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	4.42E-07	1.50E-08	mr1563_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	8.72E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224247892	NA	6.37E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251