| Variant ID: vg1224168890 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24168890 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGCGGCCGAATGTACAAATGGCAAGATCCTAGAAGCACTAAAGAAAAGGCTCGAGGGGGCAGCGAAGGGTAAATGGCTCGAGGAAATGTTATCTGTTCTC[T/C]
GGGCCCTTCGGACAACCCCCACAAGACCAACCAAATTTAGCCCGTTCATGCTTCTTTATGGCGATGAGGCAATGACCCCAGCAGAGCTAGGGGCTAACTC
GAGTTAGCCCCTAGCTCTGCTGGGGTCATTGCCTCATCGCCATAAAGAAGCATGAACGGGCTAAATTTGGTTGGTCTTGTGGGGGTTGTCCGAAGGGCCC[A/G]
GAGAACAGATAACATTTCCTCGAGCCATTTACCCTTCGCTGCCCCCTCGAGCCTTTTCTTTAGTGCTTCTAGGATCTTGCCATTTGTACATTCGGCCGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 2.60% | 0.70% | 0.08% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.33% | 0.11% | NA |
| All Japonica | 1512 | 90.30% | 8.20% | 1.46% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.18% | 0.34% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 88.70% | 8.90% | 2.35% | 0.13% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 13.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224168890 | T -> C | LOC_Os12g39260.1 | downstream_gene_variant ; 504.0bp to feature; MODIFIER | silent_mutation | Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| vg1224168890 | T -> C | LOC_Os12g39270.1 | downstream_gene_variant ; 56.0bp to feature; MODIFIER | silent_mutation | Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| vg1224168890 | T -> C | LOC_Os12g39260-LOC_Os12g39270 | intergenic_region ; MODIFIER | silent_mutation | Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| vg1224168890 | T -> DEL | N | N | silent_mutation | Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224168890 | NA | 3.27E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 8.35E-06 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | 7.77E-06 | 7.77E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 6.91E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 8.54E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 6.46E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | 9.05E-06 | 9.05E-06 | mr1976 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 6.46E-08 | mr1174_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 2.27E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224168890 | NA | 1.07E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |