Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224168890:

Variant ID: vg1224168890 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24168890
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGCCGAATGTACAAATGGCAAGATCCTAGAAGCACTAAAGAAAAGGCTCGAGGGGGCAGCGAAGGGTAAATGGCTCGAGGAAATGTTATCTGTTCTC[T/C]
GGGCCCTTCGGACAACCCCCACAAGACCAACCAAATTTAGCCCGTTCATGCTTCTTTATGGCGATGAGGCAATGACCCCAGCAGAGCTAGGGGCTAACTC

Reverse complement sequence

GAGTTAGCCCCTAGCTCTGCTGGGGTCATTGCCTCATCGCCATAAAGAAGCATGAACGGGCTAAATTTGGTTGGTCTTGTGGGGGTTGTCCGAAGGGCCC[A/G]
GAGAACAGATAACATTTCCTCGAGCCATTTACCCTTCGCTGCCCCCTCGAGCCTTTTCTTTAGTGCTTCTAGGATCTTGCCATTTGTACATTCGGCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	2.60%	0.70%	0.08%	NA
All Indica	2759	99.60%	0.00%	0.33%	0.11%	NA
All Japonica	1512	90.30%	8.20%	1.46%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	0.00%	1.18%	0.34%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.13%	0.13%	NA
Temperate Japonica	767	88.70%	8.90%	2.35%	0.13%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	13.30%	1.66%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224168890	T -> C	LOC_Os12g39260.1	downstream_gene_variant ; 504.0bp to feature; MODIFIER	silent_mutation	Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312	N	N	N	N
vg1224168890	T -> C	LOC_Os12g39270.1	downstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312	N	N	N	N
vg1224168890	T -> C	LOC_Os12g39260-LOC_Os12g39270	intergenic_region ; MODIFIER	silent_mutation	Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312	N	N	N	N
vg1224168890	T -> DEL	N	N	silent_mutation	Average:47.1; most accessible tissue: Minghui63 flag leaf, score: 81.312	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224168890	NA	3.27E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	8.35E-06	mr1174	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	7.77E-06	7.77E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	6.91E-07	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	8.54E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	6.46E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	9.05E-06	9.05E-06	mr1976	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	6.46E-08	mr1174_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	2.27E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224168890	NA	1.07E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251