\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224058121:

Variant ID: vg1224058121 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24058121
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAAAATGTAAATATTAATGAATCGCTTGTTTACAATGAATGACTAGTAACATTTTTAAATGGATGATAAGTAGAATCACTTATTCTTGATCTGTGTG[C/T]
CAAGATAAAATATGACTATCAAAATTAGGGCATATTTAGATCCATTTGGAATAGCAAATGGCAAATGGCAAAAGTTTTGGTGGCAAAAGTTTTGGCATTG

Reverse complement sequence

CAATGCCAAAACTTTTGCCACCAAAACTTTTGCCATTTGCCATTTGCTATTCCAAATGGATCTAAATATGCCCTAATTTTGATAGTCATATTTTATCTTG[G/A]
CACACAGATCAAGAATAAGTGATTCTACTTATCATCCATTTAAAAATGTTACTAGTCATTCATTGTAAACAAGCGATTCATTAATATTTACATTTTTCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.30% 0.04% 0.00% NA
All Indica  2759 79.50% 20.40% 0.07% 0.00% NA
All Japonica  1512 56.00% 44.00% 0.00% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 48.40% 51.60% 0.00% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 76.50% 23.40% 0.13% 0.00% NA
Temperate Japonica  767 24.90% 75.10% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224058121 C -> T LOC_Os12g39110.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1224058121 C -> T LOC_Os12g39100.1 downstream_gene_variant ; 3340.0bp to feature; MODIFIER silent_mutation Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1224058121 C -> T LOC_Os12g39100-LOC_Os12g39110 intergenic_region ; MODIFIER silent_mutation Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224058121 NA 3.25E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 3.31E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 5.37E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 2.56E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 1.79E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 1.95E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 9.42E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 5.19E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 4.92E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 4.08E-10 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121 NA 2.67E-07 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251