Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224058121:

Variant ID: vg1224058121 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24058121
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAAAAATGTAAATATTAATGAATCGCTTGTTTACAATGAATGACTAGTAACATTTTTAAATGGATGATAAGTAGAATCACTTATTCTTGATCTGTGTG[C/T]
CAAGATAAAATATGACTATCAAAATTAGGGCATATTTAGATCCATTTGGAATAGCAAATGGCAAATGGCAAAAGTTTTGGTGGCAAAAGTTTTGGCATTG

Reverse complement sequence

CAATGCCAAAACTTTTGCCACCAAAACTTTTGCCATTTGCCATTTGCTATTCCAAATGGATCTAAATATGCCCTAATTTTGATAGTCATATTTTATCTTG[G/A]
CACACAGATCAAGAATAAGTGATTCTACTTATCATCCATTTAAAAATGTTACTAGTCATTCATTGTAAACAAGCGATTCATTAATATTTACATTTTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.30%	0.04%	0.00%	NA
All Indica	2759	79.50%	20.40%	0.07%	0.00%	NA
All Japonica	1512	56.00%	44.00%	0.00%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	48.40%	51.60%	0.00%	0.00%	NA
Indica III	913	85.00%	15.00%	0.00%	0.00%	NA
Indica Intermediate	786	76.50%	23.40%	0.13%	0.00%	NA
Temperate Japonica	767	24.90%	75.10%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	28.20%	0.00%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224058121	C -> T	LOC_Os12g39110.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1224058121	C -> T	LOC_Os12g39100.1	downstream_gene_variant ; 3340.0bp to feature; MODIFIER	silent_mutation	Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1224058121	C -> T	LOC_Os12g39100-LOC_Os12g39110	intergenic_region ; MODIFIER	silent_mutation	Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224058121	NA	3.25E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	3.31E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	5.37E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	2.56E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	1.79E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	1.95E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	9.42E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	5.19E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	4.92E-06	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	4.08E-10	mr1910_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224058121	NA	2.67E-07	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251