\
| Variant ID: vg1224058121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24058121 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 186. )
TCGAAAAATGTAAATATTAATGAATCGCTTGTTTACAATGAATGACTAGTAACATTTTTAAATGGATGATAAGTAGAATCACTTATTCTTGATCTGTGTG[C/T]
CAAGATAAAATATGACTATCAAAATTAGGGCATATTTAGATCCATTTGGAATAGCAAATGGCAAATGGCAAAAGTTTTGGTGGCAAAAGTTTTGGCATTG
CAATGCCAAAACTTTTGCCACCAAAACTTTTGCCATTTGCCATTTGCTATTCCAAATGGATCTAAATATGCCCTAATTTTGATAGTCATATTTTATCTTG[G/A]
CACACAGATCAAGAATAAGTGATTCTACTTATCATCCATTTAAAAATGTTACTAGTCATTCATTGTAAACAAGCGATTCATTAATATTTACATTTTTCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 33.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 79.50% | 20.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 48.40% | 51.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.50% | 23.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 24.90% | 75.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224058121 | C -> T | LOC_Os12g39110.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1224058121 | C -> T | LOC_Os12g39100.1 | downstream_gene_variant ; 3340.0bp to feature; MODIFIER | silent_mutation | Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1224058121 | C -> T | LOC_Os12g39100-LOC_Os12g39110 | intergenic_region ; MODIFIER | silent_mutation | Average:36.627; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224058121 | NA | 3.25E-10 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 3.31E-06 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 5.37E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 2.56E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 1.79E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 1.95E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 9.42E-09 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 5.19E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 4.92E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 4.08E-10 | mr1910_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224058121 | NA | 2.67E-07 | mr1910_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |