\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224035880:

Variant ID: vg1224035880 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24035880
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.23, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTATCATAAAATCGCCATGGATGGAGTTACAAGCAATTTTGTTTGATCCATTTTGCTTTAAAAGAATTATTAGTACGCTTGATTATGCAATACTAT[A/G]
GCGTGCTTCAGCTGTAAACAACCAAAGGAATCACCAATCCAATCGAGGAAAAGAAAAACAGATATGAAAGAATCACCAATCGAATCAAGCAAAAGGAAAA

Reverse complement sequence

TTTTCCTTTTGCTTGATTCGATTGGTGATTCTTTCATATCTGTTTTTCTTTTCCTCGATTGGATTGGTGATTCCTTTGGTTGTTTACAGCTGAAGCACGC[T/C]
ATAGTATTGCATAATCAAGCGTACTAATAATTCTTTTAAAGCAAAATGGATCAAACAAAATTGCTTGTAACTCCATCCATGGCGATTTTATGATAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 18.80% 0.08% 0.19% NA
All Indica  2759 77.90% 21.60% 0.14% 0.33% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 8.90% 91.10% 0.00% 0.00% NA
Indica I  595 74.60% 24.90% 0.00% 0.50% NA
Indica II  465 93.10% 6.50% 0.00% 0.43% NA
Indica III  913 81.10% 18.50% 0.11% 0.33% NA
Indica Intermediate  786 67.70% 31.80% 0.38% 0.13% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224035880 A -> DEL N N silent_mutation Average:77.786; most accessible tissue: Zhenshan97 root, score: 90.684 N N N N
vg1224035880 A -> G LOC_Os12g39080.1 upstream_gene_variant ; 1911.0bp to feature; MODIFIER silent_mutation Average:77.786; most accessible tissue: Zhenshan97 root, score: 90.684 N N N N
vg1224035880 A -> G LOC_Os12g39070.1 downstream_gene_variant ; 605.0bp to feature; MODIFIER silent_mutation Average:77.786; most accessible tissue: Zhenshan97 root, score: 90.684 N N N N
vg1224035880 A -> G LOC_Os12g39070-LOC_Os12g39080 intergenic_region ; MODIFIER silent_mutation Average:77.786; most accessible tissue: Zhenshan97 root, score: 90.684 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1224035880 A G 0.03 0.03 0.03 0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224035880 NA 1.03E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 3.71E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 2.56E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 3.58E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 3.97E-09 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 4.22E-07 4.22E-07 mr1160 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 4.18E-08 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 7.21E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 5.60E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 2.49E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 1.75E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 1.22E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 3.12E-06 3.12E-06 mr1459 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 3.39E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 9.63E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 1.16E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 4.67E-10 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 8.20E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 1.03E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 2.17E-12 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 7.48E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 2.52E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 4.48E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 4.72E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224035880 NA 8.82E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251