Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224026817:

Variant ID: vg1224026817 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24026817
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAATTGTAGTGCTGTAAGAGCAAAAAGAAAGATGGAGATATTGCATCTCCTTTTTCGAAAACACACAACAAAGGAGAATGCTTCTAAATTGCCTTCTT[T/C]
CCCGTCGTGATTGAGGAGCACACTCAACAATAAAATGTTGAAGAAGATGTCTCGCCACCACCAGTGCCTCAGCTTTAAAAAGTTAAGTTGTATGGTAATC

Reverse complement sequence

GATTACCATACAACTTAACTTTTTAAAGCTGAGGCACTGGTGGTGGCGAGACATCTTCTTCAACATTTTATTGTTGAGTGTGCTCCTCAATCACGACGGG[A/G]
AAGAAGGCAATTTAGAAGCATTCTCCTTTGTTGTGTGTTTTCGAAAAAGGAGATGCAATATCTCCATCTTTCTTTTTGCTCTTACAGCACTACAATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.20%	0.21%	0.00%	NA
All Indica	2759	88.30%	11.70%	0.00%	0.00%	NA
All Japonica	1512	19.20%	80.20%	0.60%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	73.40%	26.60%	0.00%	0.00%	NA
Indica II	465	85.60%	14.40%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	10.40%	0.00%	0.00%	NA
Temperate Japonica	767	23.60%	75.50%	0.91%	0.00%	NA
Tropical Japonica	504	8.50%	91.50%	0.00%	0.00%	NA
Japonica Intermediate	241	27.40%	71.80%	0.83%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224026817	T -> C	LOC_Os12g39060.1	upstream_gene_variant ; 2344.0bp to feature; MODIFIER	silent_mutation	Average:59.778; most accessible tissue: Callus, score: 83.883	N	N	N	N
vg1224026817	T -> C	LOC_Os12g39070.1	upstream_gene_variant ; 4558.0bp to feature; MODIFIER	silent_mutation	Average:59.778; most accessible tissue: Callus, score: 83.883	N	N	N	N
vg1224026817	T -> C	LOC_Os12g39040-LOC_Os12g39060	intergenic_region ; MODIFIER	silent_mutation	Average:59.778; most accessible tissue: Callus, score: 83.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224026817	NA	3.18E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	6.88E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	1.45E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	2.48E-12	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	5.78E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	8.05E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	3.54E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	5.04E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	7.46E-08	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	1.62E-06	1.61E-06	mr1168_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	3.86E-06	3.86E-06	mr1355_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	2.20E-08	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	2.10E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	1.50E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	8.17E-17	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	5.00E-06	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	1.12E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	3.67E-07	NA	mr1546_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	1.45E-14	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	6.68E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	6.83E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	5.98E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	8.10E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	1.48E-06	1.48E-06	mr1895_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224026817	NA	4.69E-07	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251