Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224023998:

Variant ID: vg1224023998 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24023998
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTAATGTAAGGTTGTGCTGTGTTTAATTCACATTAAAATTGCAAGTTTGGTCGAAACTGAAACGATATGTCGGAAAAGTTGAAAATTTGTGTGTGCAG[A/G]
AAAGTTTTAATGTGATAAAAAAGTTAGAAGTTTAAAAAATTATTTTGGAAGTAAGCACGGCGATAGAATGAGAACATACATTACATATGGCATTCATTTC

Reverse complement sequence

GAAATGAATGCCATATGTAATGTATGTTCTCATTCTATCGCCGTGCTTACTTCCAAAATAATTTTTTAAACTTCTAACTTTTTTATCACATTAAAACTTT[T/C]
CTGCACACACAAATTTTCAACTTTTCCGACATATCGTTTCAGTTTCGACCAAACTTGCAATTTTAATGTGAATTAAACACAGCACAACCTTACATTACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.30% 0.04% 0.00% NA
All Indica  2759 88.30% 11.60% 0.04% 0.00% NA
All Japonica  1512 20.90% 79.00% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 73.60% 26.20% 0.17% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 10.70% 0.00% 0.00% NA
Temperate Japonica  767 28.30% 71.60% 0.13% 0.00% NA
Tropical Japonica  504 7.90% 92.10% 0.00% 0.00% NA
Japonica Intermediate  241 24.50% 75.50% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224023998 A -> G LOC_Os12g39040-LOC_Os12g39060 intergenic_region ; MODIFIER silent_mutation Average:38.139; most accessible tissue: Callus, score: 67.968 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224023998 NA 2.01E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 5.34E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 6.18E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 1.76E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.51E-12 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.10E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.12E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 9.72E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.48E-08 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 6.23E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 1.36E-08 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 6.80E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.84E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 5.24E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 8.85E-08 mr1456_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 8.92E-06 8.91E-06 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.24E-07 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.38E-10 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 1.87E-07 NA mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.67E-14 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 7.23E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 2.60E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 1.68E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 1.58E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224023998 NA 7.82E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251