Variant ID: vg1224009039 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 24009039 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATTAATGTTCAAACACCCCATACGATACCCTGTATAAGTACCCGACACATTAACTGGATCTAAACAACACATTAACTGCTTTTGCATTCTGCTGCTGCT[G/A]
CTGCTCTAGCATACACAGGCCTGTCAGAGGAGGAATCAACCAACGACAGCTTCAAGAACCAGGATCTGTTTGATGTTGTTGCGTCCTGTGTGAAACAAAC
GTTTGTTTCACACAGGACGCAACAACATCAAACAGATCCTGGTTCTTGAAGCTGTCGTTGGTTGATTCCTCCTCTGACAGGCCTGTGTATGCTAGAGCAG[C/T]
AGCAGCAGCAGAATGCAAAAGCAGTTAATGTGTTGTTTAGATCCAGTTAATGTGTCGGGTACTTATACAGGGTATCGTATGGGGTGTTTGAACATTAATA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.20% | 1.30% | 0.49% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 94.50% | 4.00% | 1.46% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 97.00% | 1.80% | 1.17% | 0.00% | NA |
Tropical Japonica | 504 | 96.40% | 3.00% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 82.60% | 13.30% | 4.15% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1224009039 | G -> A | LOC_Os12g39040.1 | upstream_gene_variant ; 4345.0bp to feature; MODIFIER | silent_mutation | Average:58.087; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
vg1224009039 | G -> A | LOC_Os12g39030.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.087; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1224009039 | 8.86E-07 | 8.08E-11 | mr1693 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 2.97E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 1.43E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 6.29E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 1.74E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 3.61E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 6.99E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 8.31E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | NA | 1.02E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224009039 | 7.27E-06 | 5.38E-08 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |