\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224006854:

Variant ID: vg1224006854 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24006854
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTAAACGGTTATGAAAAATTTTGGAAAAAAATTGACAACATTCATACAACACATATATACAACTTTACAGAATTTTAAGTCTAAACTCAACTCACAC[G/A]
TCGAGATATAAAAAAGACAAATTCAGCATATGAATAGTAGCATACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATTGAATTTGAAC

Reverse complement sequence

GTTCAAATTCAATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTATGCTACTATTCATATGCTGAATTTGTCTTTTTTATATCTCGA[C/T]
GTGTGAGTTGAGTTTAGACTTAAAATTCTGTAAAGTTGTATATATGTGTTGTATGAATGTTGTCAATTTTTTTCCAAAATTTTTCATAACCGTTTAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.00% 0.30% 0.00% NA
All Indica  2759 99.80% 0.10% 0.04% 0.00% NA
All Japonica  1512 90.50% 8.70% 0.79% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 90.20% 9.00% 0.78% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 19.10% 2.49% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224006854 G -> A LOC_Os12g39030.1 upstream_gene_variant ; 501.0bp to feature; MODIFIER silent_mutation Average:39.591; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg1224006854 G -> A LOC_Os12g39020-LOC_Os12g39030 intergenic_region ; MODIFIER silent_mutation Average:39.591; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224006854 6.64E-07 6.64E-07 mr1038 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854 NA 1.04E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854 6.88E-06 9.07E-10 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854 5.11E-07 1.38E-09 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251