Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1224006854:

Variant ID: vg1224006854 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24006854
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTTAAACGGTTATGAAAAATTTTGGAAAAAAATTGACAACATTCATACAACACATATATACAACTTTACAGAATTTTAAGTCTAAACTCAACTCACAC[G/A]
TCGAGATATAAAAAAGACAAATTCAGCATATGAATAGTAGCATACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATTGAATTTGAAC

Reverse complement sequence

GTTCAAATTCAATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTATGCTACTATTCATATGCTGAATTTGTCTTTTTTATATCTCGA[C/T]
GTGTGAGTTGAGTTTAGACTTAAAATTCTGTAAAGTTGTATATATGTGTTGTATGAATGTTGTCAATTTTTTTCCAAAATTTTTCATAACCGTTTAAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.70%	3.00%	0.30%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.04%	0.00%	NA
All Japonica	1512	90.50%	8.70%	0.79%	0.00%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	90.20%	9.00%	0.78%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	78.40%	19.10%	2.49%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224006854	G -> A	LOC_Os12g39030.1	upstream_gene_variant ; 501.0bp to feature; MODIFIER	silent_mutation	Average:39.591; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg1224006854	G -> A	LOC_Os12g39020-LOC_Os12g39030	intergenic_region ; MODIFIER	silent_mutation	Average:39.591; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224006854	6.64E-07	6.64E-07	mr1038	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854	NA	1.04E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854	6.88E-06	9.07E-10	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224006854	5.11E-07	1.38E-09	mr1745	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251