\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223942507:

Variant ID: vg1223942507 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23942507
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AATGAAAAAAACCAAGAAATCAAATTCAAAATTAAGTTCTAAAATTTAATTTTGGGTTATAAGCATAAGCATAAGCCAAACAATTAGCCCTTTTTTCACC[A/G]
GAGGGCGCACTTTTTATATATGAGTCGTCGAATGAAGGATTCTTTTTTTGGAGCATTATGTGTTGTGTTCTAGTGCAAACTCATATACCGACTCATGATA

Reverse complement sequence

TATCATGAGTCGGTATATGAGTTTGCACTAGAACACAACACATAATGCTCCAAAAAAAGAATCCTTCATTCGACGACTCATATATAAAAAGTGCGCCCTC[T/C]
GGTGAAAAAAGGGCTAATTGTTTGGCTTATGCTTATGCTTATAACCCAAAATTAAATTTTAGAACTTAATTTTGAATTTGATTTCTTGGTTTTTTTCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 10.00% 3.36% 3.00% NA
All Indica  2759 94.20% 0.50% 0.18% 5.07% NA
All Japonica  1512 61.50% 29.30% 9.13% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.50% 0.17% NA
Indica II  465 79.40% 1.30% 0.22% 19.14% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 93.00% 0.90% 0.13% 5.98% NA
Temperate Japonica  767 38.30% 49.40% 12.13% 0.13% NA
Tropical Japonica  504 89.30% 5.80% 4.96% 0.00% NA
Japonica Intermediate  241 77.20% 14.50% 8.30% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 71.10% 14.40% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223942507 A -> DEL N N silent_mutation Average:59.25; most accessible tissue: Callus, score: 80.224 N N N N
vg1223942507 A -> G LOC_Os12g38930.1 upstream_gene_variant ; 1084.0bp to feature; MODIFIER silent_mutation Average:59.25; most accessible tissue: Callus, score: 80.224 N N N N
vg1223942507 A -> G LOC_Os12g38940.1 downstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:59.25; most accessible tissue: Callus, score: 80.224 N N N N
vg1223942507 A -> G LOC_Os12g38930-LOC_Os12g38940 intergenic_region ; MODIFIER silent_mutation Average:59.25; most accessible tissue: Callus, score: 80.224 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223942507 NA 1.83E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223942507 NA 4.26E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223942507 NA 7.77E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223942507 1.51E-09 NA mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223942507 NA 2.03E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251