\
| Variant ID: vg1223934169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23934169 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.12, others allele: 0.00, population size: 245. )
GTCCAAATGTTCTCGACACAATGACTCATCATATTTACAATCTTGGTGCTGGTAAGTACTTCCTAGATATAATGTTAGAACCACTCCTTAATTCATCTTT[G/T]
TTTTTAGGTTGTACTACACATTTAAGATGACTGACATAAACCAAATTTTATTAGGTAACGATCCGCAAGTTGCAAATAGGATCTTGAATCCGCAGTATTT
AAATACTGCGGATTCAAGATCCTATTTGCAACTTGCGGATCGTTACCTAATAAAATTTGGTTTATGTCAGTCATCTTAAATGTGTAGTACAACCTAAAAA[C/A]
AAAGATGAATTAAGGAGTGGTTCTAACATTATATCTAGGAAGTACTTACCAGCACCAAGATTGTAAATATGATGAGTCATTGTGTCGAGAACATTTGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 31.90% | 0.08% | 0.34% | NA |
| All Indica | 2759 | 58.50% | 40.80% | 0.11% | 0.58% | NA |
| All Japonica | 1512 | 92.20% | 7.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.80% | 22.50% | 0.17% | 0.50% | NA |
| Indica II | 465 | 91.60% | 8.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 31.00% | 68.00% | 0.11% | 0.88% | NA |
| Indica Intermediate | 786 | 56.90% | 42.60% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223934169 | G -> DEL | N | N | silent_mutation | Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1223934169 | G -> T | LOC_Os12g38930.1 | downstream_gene_variant ; 1712.0bp to feature; MODIFIER | silent_mutation | Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1223934169 | G -> T | LOC_Os12g38920.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1223934169 | G -> T | LOC_Os12g38920.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223934169 | NA | 1.05E-17 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1223934169 | NA | 1.75E-10 | mr1066 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 1.18E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 1.54E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 4.27E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 4.49E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 1.13E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 3.46E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 5.01E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 6.73E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223934169 | NA | 6.07E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |