\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223934169:

Variant ID: vg1223934169 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23934169
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.12, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCAAATGTTCTCGACACAATGACTCATCATATTTACAATCTTGGTGCTGGTAAGTACTTCCTAGATATAATGTTAGAACCACTCCTTAATTCATCTTT[G/T]
TTTTTAGGTTGTACTACACATTTAAGATGACTGACATAAACCAAATTTTATTAGGTAACGATCCGCAAGTTGCAAATAGGATCTTGAATCCGCAGTATTT

Reverse complement sequence

AAATACTGCGGATTCAAGATCCTATTTGCAACTTGCGGATCGTTACCTAATAAAATTTGGTTTATGTCAGTCATCTTAAATGTGTAGTACAACCTAAAAA[C/A]
AAAGATGAATTAAGGAGTGGTTCTAACATTATATCTAGGAAGTACTTACCAGCACCAAGATTGTAAATATGATGAGTCATTGTGTCGAGAACATTTGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 31.90% 0.08% 0.34% NA
All Indica  2759 58.50% 40.80% 0.11% 0.58% NA
All Japonica  1512 92.20% 7.70% 0.07% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 76.80% 22.50% 0.17% 0.50% NA
Indica II  465 91.60% 8.00% 0.00% 0.43% NA
Indica III  913 31.00% 68.00% 0.11% 0.88% NA
Indica Intermediate  786 56.90% 42.60% 0.13% 0.38% NA
Temperate Japonica  767 96.60% 3.30% 0.13% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223934169 G -> DEL N N silent_mutation Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1223934169 G -> T LOC_Os12g38930.1 downstream_gene_variant ; 1712.0bp to feature; MODIFIER silent_mutation Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1223934169 G -> T LOC_Os12g38920.1 intron_variant ; MODIFIER silent_mutation Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1223934169 G -> T LOC_Os12g38920.2 intron_variant ; MODIFIER silent_mutation Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223934169 NA 1.05E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223934169 NA 1.75E-10 mr1066 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 1.18E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 1.54E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 4.27E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 4.49E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 1.13E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 3.46E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 5.01E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 6.73E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169 NA 6.07E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251