\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223876846:

Variant ID: vg1223876846 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23876846
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTTAAGTCCCTATCACATCGGATGTTTGAACACTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGC[A/G]
AGATGAATCTATTGAGCCTAATTAATCCATAATTAGCCTATGTGATGCTACAGTAAACATTCTCTAATTATGGATTAATTAGGCTTAAAATTTTTGTCTC

Reverse complement sequence

GAGACAAAAATTTTAAGCCTAATTAATCCATAATTAGAGAATGTTTACTGTAGCATCACATAGGCTAATTATGGATTAATTAGGCTCAATAGATTCATCT[T/C]
GCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTTCAAACATCCGATGTGATAGGGACTTAAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 37.20% 4.42% 2.24% NA
All Indica  2759 85.30% 4.30% 7.07% 3.30% NA
All Japonica  1512 1.20% 98.70% 0.13% 0.00% NA
Aus  269 88.10% 3.00% 3.35% 5.58% NA
Indica I  595 84.00% 0.70% 13.45% 1.85% NA
Indica II  465 75.50% 13.30% 7.31% 3.87% NA
Indica III  913 89.90% 1.60% 4.27% 4.16% NA
Indica Intermediate  786 86.60% 5.00% 5.34% 3.05% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.00% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.41% 0.00% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223876846 A -> DEL N N silent_mutation Average:37.34; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1223876846 A -> G LOC_Os12g38850.1 upstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:37.34; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1223876846 A -> G LOC_Os12g38850.2 upstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:37.34; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1223876846 A -> G LOC_Os12g38850.3 upstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:37.34; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1223876846 A -> G LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:37.34; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223876846 9.35E-07 6.92E-16 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 2.94E-14 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.50E-30 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.55E-16 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.69E-14 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 4.07E-07 1.22E-17 mr1055 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 3.90E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 6.37E-09 3.20E-19 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 2.08E-09 3.67E-17 mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.45E-14 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 2.47E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 4.74E-15 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.48E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 7.67E-07 NA mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 1.06E-09 1.39E-20 mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 9.96E-08 3.01E-13 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 2.72E-07 2.86E-52 mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 1.90E-09 3.50E-20 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 5.87E-07 6.14E-16 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 9.04E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 5.20E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 3.15E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.45E-14 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 7.07E-12 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 4.93E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.59E-15 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 3.28E-14 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 2.91E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 8.59E-16 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.13E-23 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 6.23E-11 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.29E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223876846 NA 1.37E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251