\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223869386:

Variant ID: vg1223869386 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 23869386
Reference Allele: ATTAlternative Allele: TTT,AT,ATTT,A
Primary Allele: TTTSecondary Allele: ATT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTATTACATCTATGTATAAAGTCGCATCTTCAAATTCATTCTGCATAGAGAGTAACAAAATGGACAAAATTCTAACACAATTACAACCTTAAAACTATC[ATT/TTT,AT,ATTT,A]
TTTTTTTGTTATAGCTAAAATATAATGAATTTGAGGTTAAGATTTTATCCCTAGGTGTAATACTATTGAAAGTACATGTATGAATTTTTTTTTCTAGATT

Reverse complement sequence

AATCTAGAAAAAAAAATTCATACATGTACTTTCAATAGTATTACACCTAGGGATAAAATCTTAACCTCAAATTCATTATATTTTAGCTATAACAAAAAAA[AAT/AAA,AT,AAAT,T]
GATAGTTTTAAGGTTGTAATTGTGTTAGAATTTTGTCCATTTTGTTACTCTCTATGCAGAATGAATTTGAAGATGCGACTTTATACATAGATGTAATACT

Allele Frequencies:

Populations Population SizeFrequency of TTT(primary allele) Frequency of ATT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 32.60% 0.99% 6.01% AT: 4.42%; ATTT: 0.66%; A: 0.04%
All Indica  2759 93.10% 2.40% 0.58% 1.12% AT: 2.79%; A: 0.04%
All Japonica  1512 0.90% 89.60% 0.73% 0.00% AT: 8.13%; ATTT: 0.60%; A: 0.07%
Aus  269 0.00% 6.70% 5.20% 87.36% AT: 0.74%
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 84.50% 4.50% 0.43% 0.22% AT: 10.32%
Indica III  913 96.40% 2.30% 0.44% 0.66% AT: 0.22%
Indica Intermediate  786 89.80% 2.40% 1.15% 3.05% AT: 3.44%; A: 0.13%
Temperate Japonica  767 0.80% 95.70% 0.78% 0.00% AT: 2.61%; A: 0.13%
Tropical Japonica  504 1.20% 81.00% 0.20% 0.00% AT: 16.67%; ATTT: 0.99%
Japonica Intermediate  241 0.40% 88.40% 1.66% 0.00% AT: 7.88%; ATTT: 1.66%
VI/Aromatic  96 1.00% 60.40% 5.21% 9.38% ATTT: 21.88%; AT: 2.08%
Intermediate  90 31.10% 51.10% 1.11% 10.00% AT: 5.56%; ATTT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223869386 ATT -> A LOC_Os12g38840.1 upstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> A LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> AT LOC_Os12g38840.1 upstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> AT LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> ATTT LOC_Os12g38840.1 upstream_gene_variant ; 2943.0bp to feature; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> ATTT LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> DEL N N silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> TTT LOC_Os12g38840.1 upstream_gene_variant ; 2940.0bp to feature; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg1223869386 ATT -> TTT LOC_Os12g38840-LOC_Os12g38850 intergenic_region ; MODIFIER silent_mutation Average:46.288; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223869386 9.59E-06 1.17E-48 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 2.73E-06 1.20E-28 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.75E-34 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.35E-24 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.44E-07 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.17E-34 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 3.94E-06 2.01E-26 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.66E-60 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.69E-20 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 2.29E-23 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 5.32E-47 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 4.49E-07 5.30E-31 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 6.06E-06 5.00E-22 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.94E-61 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 3.51E-06 1.84E-22 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 1.44E-06 1.26E-24 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 7.34E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 9.65E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.93E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.62E-13 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.22E-54 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.65E-25 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.68E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.02E-14 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.50E-55 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 6.02E-06 7.91E-25 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.00E-64 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 5.89E-07 9.93E-25 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 5.36E-33 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.38E-15 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.14E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 7.15E-09 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 8.16E-07 1.49E-43 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 1.98E-07 5.66E-31 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.64E-17 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.97E-48 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 5.42E-07 1.13E-28 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 9.38E-07 7.80E-29 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.08E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 5.48E-06 1.00E-27 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.02E-74 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 8.48E-29 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 9.30E-39 mr1181_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.14E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.04E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 2.30E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.25E-62 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 2.25E-06 1.02E-30 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 8.52E-06 8.52E-06 mr1391_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 2.23E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.58E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.79E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 5.09E-06 1.10E-17 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.50E-63 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.14E-26 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 2.79E-45 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 9.17E-13 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 4.86E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 8.95E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 2.10E-48 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 5.62E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 6.34E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 3.62E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 1.12E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 5.82E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223869386 NA 5.93E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251