\
| Variant ID: vg1223868448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23868448 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATCCAAACAATTGTTTTAAAGCATTCTTCTGTTTCTATTTTCCGGAAGAATTCGCAAGGCATGCATCTTAATTCTAAGTTTTTTATAACCCTGTGTTTT[A/T]
AAATTTTGGCGTTACAAAGGAGCCCTTAATTCTAAGAACGAAACAAGTGTTGAAATATAATATCAGTTTAAGCTTTTAAATGAGTGATTTGTTCACATAA
TTATGTGAACAAATCACTCATTTAAAAGCTTAAACTGATATTATATTTCAACACTTGTTTCGTTCTTAGAATTAAGGGCTCCTTTGTAACGCCAAAATTT[T/A]
AAAACACAGGGTTATAAAAAACTTAGAATTAAGATGCATGCCTTGCGAATTCTTCCGGAAAATAGAAACAGAAGAATGCTTTAAAACAATTGTTTGGATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.70% | 90.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 18.30% | 81.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 46.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223868448 | A -> T | LOC_Os12g38840.1 | upstream_gene_variant ; 2002.0bp to feature; MODIFIER | silent_mutation | Average:30.579; most accessible tissue: Callus, score: 65.884 | N | N | N | N |
| vg1223868448 | A -> T | LOC_Os12g38840-LOC_Os12g38850 | intergenic_region ; MODIFIER | silent_mutation | Average:30.579; most accessible tissue: Callus, score: 65.884 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223868448 | NA | 2.22E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 2.14E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | 3.15E-06 | 6.48E-40 | mr1882 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 6.45E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 6.74E-22 | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 3.39E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 2.00E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 5.23E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223868448 | NA | 1.58E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |