\
| Variant ID: vg1223866038 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23866038 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.20, others allele: 0.00, population size: 82. )
TATCGTAGTGCTTTGCAAACAGGGCATGCTTCTAGGTTCTCGTACTCCTCACCGCAATATAGGATACAATCATTTGGACATGCGTGAATCTTCTGAACTT[A/C]
CAGTCCTAGAGGGCAGACTATCTTCTCAGCCTCGTACGTTGTCTCGGGCAATTTGTTTCTCTTCGGAAGAATGTTCTTGACGAGTCTCAATAAATCACCA
TGGTGATTTATTGAGACTCGTCAAGAACATTCTTCCGAAGAGAAACAAATTGCCCGAGACAACGTACGAGGCTGAGAAGATAGTCTGCCCTCTAGGACTG[T/G]
AAGTTCAGAAGATTCACGCATGTCCAAATGATTGTATCCTATATTGCGGTGAGGAGTACGAGAACCTAGAAGCATGCCCTGTTTGCAAAGCACTACGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 3.50% | 44.22% | 23.11% | NA |
| All Indica | 2759 | 3.30% | 5.50% | 58.72% | 32.51% | NA |
| All Japonica | 1512 | 76.30% | 0.10% | 11.71% | 11.90% | NA |
| Aus | 269 | 2.60% | 3.00% | 92.19% | 2.23% | NA |
| Indica I | 595 | 1.70% | 4.90% | 53.95% | 39.50% | NA |
| Indica II | 465 | 5.60% | 3.40% | 66.88% | 24.09% | NA |
| Indica III | 913 | 3.00% | 7.90% | 60.46% | 28.70% | NA |
| Indica Intermediate | 786 | 3.60% | 4.30% | 55.47% | 36.64% | NA |
| Temperate Japonica | 767 | 84.90% | 0.00% | 5.48% | 9.65% | NA |
| Tropical Japonica | 504 | 72.20% | 0.20% | 17.66% | 9.92% | NA |
| Japonica Intermediate | 241 | 57.70% | 0.00% | 19.09% | 23.24% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 4.40% | 37.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223866038 | A -> C | LOC_Os12g38840.1 | N | splice_donor_variant | Average:10.204; most accessible tissue: Callus, score: 26.731 | N | N | N | N |
| vg1223866038 | A -> DEL | LOC_Os12g38840.1 | N | splice_donor_variant | Average:10.204; most accessible tissue: Callus, score: 26.731 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223866038 | NA | 4.45E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 7.06E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 2.95E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 3.46E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | 9.00E-06 | 2.43E-08 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 4.11E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | 3.02E-06 | 1.82E-22 | mr1657_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 1.34E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223866038 | NA | 7.69E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |