\
| Variant ID: vg1223833401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23833401 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )
GTGTTGATCATGTTGTTGATTCTATGTAGAACCCAGTGAAACCTCTGGGGAAAGAGCCCACTGAACCGATTGATGTTGTGCTACATAGCGAGATTCGCTC[T/G]
GTCGGTCGCGCCAGGTTCGATCACCAAGTGAGTAGTAAATTTTGTAATGCTAGATCGCCCTCGACGAGTTCCTAAACGTCTTGACGGTTTATCTTCAATC
GATTGAAGATAAACCGTCAAGACGTTTAGGAACTCGTCGAGGGCGATCTAGCATTACAAAATTTACTACTCACTTGGTGATCGAACCTGGCGCGACCGAC[A/C]
GAGCGAATCTCGCTATGTAGCACAACATCAATCGGTTCAGTGGGCTCTTTCCCCAGAGGTTTCACTGGGTTCTACATAGAATCAACAACATGATCAACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 28.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 24.30% | 75.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.20% | 71.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223833401 | T -> G | LOC_Os12g38790.1 | synonymous_variant ; p.Ser332Ser; LOW | synonymous_codon | Average:61.536; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg1223833401 | T -> G | LOC_Os12g38790.1 | synonymous_variant ; p.Ser332Ser; LOW | nonsynonymous_codon ; S332A | Average:61.536; most accessible tissue: Zhenshan97 flower, score: 71.992 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223833401 | NA | 1.14E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 2.70E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 6.38E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 1.24E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 5.52E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 2.40E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | 8.66E-06 | NA | mr1428_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 2.21E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 1.44E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 4.33E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | 6.41E-07 | 1.34E-23 | mr1657_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 1.94E-13 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223833401 | NA | 1.35E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |