\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223831003:

Variant ID: vg1223831003 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23831003
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACTAAACTTTTTCCTAACACACAAAAGTTTTTGTGTGTCGGAATATGTATTAGACGGTAGCAAGATAAAAATATGACGTGCAAACTATATATGTGCA[G/A]
GTTAAACTACAAAATGGAAATCCAAGTGATTTTAACCTCTCACAATCTTTCTAATCTAATACTAAGAACTTGGTTCTTACCTACTTCGAAAATAAGTTAC

Reverse complement sequence

GTAACTTATTTTCGAAGTAGGTAAGAACCAAGTTCTTAGTATTAGATTAGAAAGATTGTGAGAGGTTAAAATCACTTGGATTTCCATTTTGTAGTTTAAC[C/T]
TGCACATATATAGTTTGCACGTCATATTTTTATCTTGCTACCGTCTAATACATATTCCGACACACAAAAACTTTTGTGTGTTAGGAAAAAGTTTAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.20% 0.15% 0.00% NA
All Indica  2759 92.70% 7.10% 0.22% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 77.00% 22.20% 0.84% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.40% 2.50% 0.11% 0.00% NA
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223831003 G -> A LOC_Os12g38780.1 upstream_gene_variant ; 1478.0bp to feature; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N
vg1223831003 G -> A LOC_Os12g38790.1 upstream_gene_variant ; 644.0bp to feature; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N
vg1223831003 G -> A LOC_Os12g38795.1 upstream_gene_variant ; 4250.0bp to feature; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N
vg1223831003 G -> A LOC_Os12g38780.2 upstream_gene_variant ; 1478.0bp to feature; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N
vg1223831003 G -> A LOC_Os12g38795.2 upstream_gene_variant ; 4210.0bp to feature; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N
vg1223831003 G -> A LOC_Os12g38780-LOC_Os12g38790 intergenic_region ; MODIFIER silent_mutation Average:50.961; most accessible tissue: Callus, score: 79.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223831003 1.36E-07 1.20E-12 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 4.19E-07 1.75E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 3.92E-08 2.22E-14 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 3.97E-07 1.01E-12 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 2.01E-07 5.69E-13 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 1.02E-06 8.25E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 6.88E-08 1.93E-12 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223831003 2.79E-07 6.09E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251