\
| Variant ID: vg1223831003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23831003 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )
AAAACTAAACTTTTTCCTAACACACAAAAGTTTTTGTGTGTCGGAATATGTATTAGACGGTAGCAAGATAAAAATATGACGTGCAAACTATATATGTGCA[G/A]
GTTAAACTACAAAATGGAAATCCAAGTGATTTTAACCTCTCACAATCTTTCTAATCTAATACTAAGAACTTGGTTCTTACCTACTTCGAAAATAAGTTAC
GTAACTTATTTTCGAAGTAGGTAAGAACCAAGTTCTTAGTATTAGATTAGAAAGATTGTGAGAGGTTAAAATCACTTGGATTTCCATTTTGTAGTTTAAC[C/T]
TGCACATATATAGTTTGCACGTCATATTTTTATCTTGCTACCGTCTAATACATATTCCGACACACAAAAACTTTTGTGTGTTAGGAAAAAGTTTAGTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 4.20% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.00% | 22.20% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223831003 | G -> A | LOC_Os12g38780.1 | upstream_gene_variant ; 1478.0bp to feature; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| vg1223831003 | G -> A | LOC_Os12g38790.1 | upstream_gene_variant ; 644.0bp to feature; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| vg1223831003 | G -> A | LOC_Os12g38795.1 | upstream_gene_variant ; 4250.0bp to feature; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| vg1223831003 | G -> A | LOC_Os12g38780.2 | upstream_gene_variant ; 1478.0bp to feature; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| vg1223831003 | G -> A | LOC_Os12g38795.2 | upstream_gene_variant ; 4210.0bp to feature; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| vg1223831003 | G -> A | LOC_Os12g38780-LOC_Os12g38790 | intergenic_region ; MODIFIER | silent_mutation | Average:50.961; most accessible tissue: Callus, score: 79.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223831003 | 1.36E-07 | 1.20E-12 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 4.19E-07 | 1.75E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 3.92E-08 | 2.22E-14 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 3.97E-07 | 1.01E-12 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 2.01E-07 | 5.69E-13 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 1.02E-06 | 8.25E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 6.88E-08 | 1.93E-12 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223831003 | 2.79E-07 | 6.09E-12 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |