\
| Variant ID: vg1223790057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23790057 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 100. )
GAACATAAGAGTGGAGGATTTAAAAAAGTAATAATTTAATAGAGAAGGGGTCATAATTAATTCCCTACATGCATGCATGTCTTATATTATGGAGCATTAA[G/A]
AAAATGGTTGTGTCTTATATTATGGAATGGAGGGAGTACCTGCTTACTTCACTCATCAATCAAGTTAAAATAGCGTCAACCGTTTATTTTTCTTTGAGAT
ATCTCAAAGAAAAATAAACGGTTGACGCTATTTTAACTTGATTGATGAGTGAAGTAAGCAGGTACTCCCTCCATTCCATAATATAAGACACAACCATTTT[C/T]
TTAATGCTCCATAATATAAGACATGCATGCATGTAGGGAATTAATTATGACCCCTTCTCTATTAAATTATTACTTTTTTAAATCCTCCACTCTTATGTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 28.30% | 0.04% | 0.40% | NA |
| All Indica | 2759 | 97.10% | 2.30% | 0.04% | 0.62% | NA |
| All Japonica | 1512 | 24.10% | 75.70% | 0.07% | 0.13% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 4.30% | 0.22% | 2.58% | NA |
| Indica III | 913 | 97.70% | 2.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 97.20% | 2.30% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 15.50% | 84.20% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 28.40% | 71.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.70% | 56.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223790057 | G -> DEL | N | N | silent_mutation | Average:60.853; most accessible tissue: Callus, score: 74.468 | N | N | N | N |
| vg1223790057 | G -> A | LOC_Os12g38730.1 | downstream_gene_variant ; 4280.0bp to feature; MODIFIER | silent_mutation | Average:60.853; most accessible tissue: Callus, score: 74.468 | N | N | N | N |
| vg1223790057 | G -> A | LOC_Os12g38730.2 | downstream_gene_variant ; 4280.0bp to feature; MODIFIER | silent_mutation | Average:60.853; most accessible tissue: Callus, score: 74.468 | N | N | N | N |
| vg1223790057 | G -> A | LOC_Os12g38720-LOC_Os12g38730 | intergenic_region ; MODIFIER | silent_mutation | Average:60.853; most accessible tissue: Callus, score: 74.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223790057 | NA | 1.26E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 3.35E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 4.90E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 2.52E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 9.39E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 1.90E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 7.44E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 2.15E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | NA | 6.20E-21 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223790057 | 1.42E-06 | 1.38E-15 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |