\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223765454:

Variant ID: vg1223765454 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23765454
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.50, A: 0.41, T: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCGTCGTCAAATCTGAGGAGCGAGAGCTCAACCCGAACAACAAACCCTGCATGGAACAAGCCGATAGGAAACACATAGGAAGAAAGAGCCTAAATCCA[A/G,T]
ATCCCCATATCCACTAAAGAACTCGAATGGTGGCAAACGAATTGCTGTCTTCGTGGATTGACGTACGTGGATGGGGAAGTGAAAATCTGCAAAGCATGAC

Reverse complement sequence

GTCATGCTTTGCAGATTTTCACTTCCCCATCCACGTACGTCAATCCACGAAGACAGCAATTCGTTTGCCACCATTCGAGTTCTTTAGTGGATATGGGGAT[T/C,A]
TGGATTTAGGCTCTTTCTTCCTATGTGTTTCCTATCGGCTTGTTCCATGCAGGGTTTGTTGTTCGGGTTGAGCTCTCGCTCCTCAGATTTGACGACGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 19.80% 17.14% 33.45% T: 0.02%
All Indica  2759 3.80% 30.20% 15.22% 50.78% NA
All Japonica  1512 76.60% 5.80% 13.10% 4.50% NA
Aus  269 4.10% 0.70% 62.45% 32.34% T: 0.37%
Indica I  595 2.90% 10.30% 16.97% 69.92% NA
Indica II  465 5.80% 16.80% 18.06% 59.35% NA
Indica III  913 3.10% 46.90% 11.83% 38.23% NA
Indica Intermediate  786 4.10% 34.00% 16.16% 45.80% NA
Temperate Japonica  767 85.30% 2.70% 10.56% 1.43% NA
Tropical Japonica  504 72.20% 6.90% 11.51% 9.33% NA
Japonica Intermediate  241 58.10% 13.30% 24.48% 4.15% NA
VI/Aromatic  96 87.50% 1.00% 7.29% 4.17% NA
Intermediate  90 47.80% 10.00% 18.89% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223765454 A -> DEL N N silent_mutation Average:17.436; most accessible tissue: Callus, score: 31.294 N N N N
vg1223765454 A -> G LOC_Os12g38690.1 upstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:17.436; most accessible tissue: Callus, score: 31.294 N N N N
vg1223765454 A -> G LOC_Os12g38690-LOC_Os12g38700 intergenic_region ; MODIFIER silent_mutation Average:17.436; most accessible tissue: Callus, score: 31.294 N N N N
vg1223765454 A -> T LOC_Os12g38690.1 upstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:17.436; most accessible tissue: Callus, score: 31.294 N N N N
vg1223765454 A -> T LOC_Os12g38690-LOC_Os12g38700 intergenic_region ; MODIFIER silent_mutation Average:17.436; most accessible tissue: Callus, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223765454 NA 2.44E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 9.46E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 4.08E-06 NA mr1670 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 2.93E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 5.89E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 3.68E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 2.56E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 1.61E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 2.15E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 3.10E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 1.88E-21 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 1.37E-13 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454 NA 3.34E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251