Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223765454:

Variant ID: vg1223765454 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23765454
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.50, A: 0.41, T: 0.09, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCGTCGTCAAATCTGAGGAGCGAGAGCTCAACCCGAACAACAAACCCTGCATGGAACAAGCCGATAGGAAACACATAGGAAGAAAGAGCCTAAATCCA[A/G,T]
ATCCCCATATCCACTAAAGAACTCGAATGGTGGCAAACGAATTGCTGTCTTCGTGGATTGACGTACGTGGATGGGGAAGTGAAAATCTGCAAAGCATGAC

Reverse complement sequence

GTCATGCTTTGCAGATTTTCACTTCCCCATCCACGTACGTCAATCCACGAAGACAGCAATTCGTTTGCCACCATTCGAGTTCTTTAGTGGATATGGGGAT[T/C,A]
TGGATTTAGGCTCTTTCTTCCTATGTGTTTCCTATCGGCTTGTTCCATGCAGGGTTTGTTGTTCGGGTTGAGCTCTCGCTCCTCAGATTTGACGACGGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.60%	19.80%	17.14%	33.45%	T: 0.02%
All Indica	2759	3.80%	30.20%	15.22%	50.78%	NA
All Japonica	1512	76.60%	5.80%	13.10%	4.50%	NA
Aus	269	4.10%	0.70%	62.45%	32.34%	T: 0.37%
Indica I	595	2.90%	10.30%	16.97%	69.92%	NA
Indica II	465	5.80%	16.80%	18.06%	59.35%	NA
Indica III	913	3.10%	46.90%	11.83%	38.23%	NA
Indica Intermediate	786	4.10%	34.00%	16.16%	45.80%	NA
Temperate Japonica	767	85.30%	2.70%	10.56%	1.43%	NA
Tropical Japonica	504	72.20%	6.90%	11.51%	9.33%	NA
Japonica Intermediate	241	58.10%	13.30%	24.48%	4.15%	NA
VI/Aromatic	96	87.50%	1.00%	7.29%	4.17%	NA
Intermediate	90	47.80%	10.00%	18.89%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223765454	A -> DEL	N	N	silent_mutation	Average:17.436; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765454	A -> G	LOC_Os12g38690.1	upstream_gene_variant ; 2884.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765454	A -> G	LOC_Os12g38690-LOC_Os12g38700	intergenic_region ; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765454	A -> T	LOC_Os12g38690.1	upstream_gene_variant ; 2884.0bp to feature; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765454	A -> T	LOC_Os12g38690-LOC_Os12g38700	intergenic_region ; MODIFIER	silent_mutation	Average:17.436; most accessible tissue: Callus, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223765454	NA	2.44E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	9.46E-20	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	4.08E-06	NA	mr1670	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	2.93E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	5.89E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	3.68E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	2.56E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	1.61E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	2.15E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	3.10E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	1.88E-21	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	1.37E-13	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765454	NA	3.34E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251