\
| Variant ID: vg1223765454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23765454 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.50, A: 0.41, T: 0.09, others allele: 0.00, population size: 82. )
GTCCGTCGTCAAATCTGAGGAGCGAGAGCTCAACCCGAACAACAAACCCTGCATGGAACAAGCCGATAGGAAACACATAGGAAGAAAGAGCCTAAATCCA[A/G,T]
ATCCCCATATCCACTAAAGAACTCGAATGGTGGCAAACGAATTGCTGTCTTCGTGGATTGACGTACGTGGATGGGGAAGTGAAAATCTGCAAAGCATGAC
GTCATGCTTTGCAGATTTTCACTTCCCCATCCACGTACGTCAATCCACGAAGACAGCAATTCGTTTGCCACCATTCGAGTTCTTTAGTGGATATGGGGAT[T/C,A]
TGGATTTAGGCTCTTTCTTCCTATGTGTTTCCTATCGGCTTGTTCCATGCAGGGTTTGTTGTTCGGGTTGAGCTCTCGCTCCTCAGATTTGACGACGGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 19.80% | 17.14% | 33.45% | T: 0.02% |
| All Indica | 2759 | 3.80% | 30.20% | 15.22% | 50.78% | NA |
| All Japonica | 1512 | 76.60% | 5.80% | 13.10% | 4.50% | NA |
| Aus | 269 | 4.10% | 0.70% | 62.45% | 32.34% | T: 0.37% |
| Indica I | 595 | 2.90% | 10.30% | 16.97% | 69.92% | NA |
| Indica II | 465 | 5.80% | 16.80% | 18.06% | 59.35% | NA |
| Indica III | 913 | 3.10% | 46.90% | 11.83% | 38.23% | NA |
| Indica Intermediate | 786 | 4.10% | 34.00% | 16.16% | 45.80% | NA |
| Temperate Japonica | 767 | 85.30% | 2.70% | 10.56% | 1.43% | NA |
| Tropical Japonica | 504 | 72.20% | 6.90% | 11.51% | 9.33% | NA |
| Japonica Intermediate | 241 | 58.10% | 13.30% | 24.48% | 4.15% | NA |
| VI/Aromatic | 96 | 87.50% | 1.00% | 7.29% | 4.17% | NA |
| Intermediate | 90 | 47.80% | 10.00% | 18.89% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223765454 | A -> DEL | N | N | silent_mutation | Average:17.436; most accessible tissue: Callus, score: 31.294 | N | N | N | N |
| vg1223765454 | A -> G | LOC_Os12g38690.1 | upstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:17.436; most accessible tissue: Callus, score: 31.294 | N | N | N | N |
| vg1223765454 | A -> G | LOC_Os12g38690-LOC_Os12g38700 | intergenic_region ; MODIFIER | silent_mutation | Average:17.436; most accessible tissue: Callus, score: 31.294 | N | N | N | N |
| vg1223765454 | A -> T | LOC_Os12g38690.1 | upstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:17.436; most accessible tissue: Callus, score: 31.294 | N | N | N | N |
| vg1223765454 | A -> T | LOC_Os12g38690-LOC_Os12g38700 | intergenic_region ; MODIFIER | silent_mutation | Average:17.436; most accessible tissue: Callus, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223765454 | NA | 2.44E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 9.46E-20 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | 4.08E-06 | NA | mr1670 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 2.93E-07 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 5.89E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 3.68E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 2.56E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 1.61E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 2.15E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 3.10E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 1.88E-21 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 1.37E-13 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223765454 | NA | 3.34E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |