Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223765446:

Variant ID: vg1223765446 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23765446
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.39, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TCCACGGAGTCCGTCGTCAAATCTGAGGAGCGAGAGCTCAACCCGAACAACAAACCCTGCATGGAACAAGCCGATAGGAAACACATAGGAAGAAAGAGCC[T/C]
AAATCCAAATCCCCATATCCACTAAAGAACTCGAATGGTGGCAAACGAATTGCTGTCTTCGTGGATTGACGTACGTGGATGGGGAAGTGAAAATCTGCAA

Reverse complement sequence

TTGCAGATTTTCACTTCCCCATCCACGTACGTCAATCCACGAAGACAGCAATTCGTTTGCCACCATTCGAGTTCTTTAGTGGATATGGGGATTTGGATTT[A/G]
GGCTCTTTCTTCCTATGTGTTTCCTATCGGCTTGTTCCATGCAGGGTTTGTTGTTCGGGTTGAGCTCTCGCTCCTCAGATTTGACGACGGACTCCGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.60%	18.50%	12.72%	39.15%	NA
All Indica	2759	3.80%	30.90%	13.34%	52.01%	NA
All Japonica	1512	76.70%	0.70%	2.91%	19.71%	NA
Aus	269	4.10%	1.10%	62.08%	32.71%	NA
Indica I	595	2.90%	10.60%	15.97%	70.59%	NA
Indica II	465	5.60%	18.30%	15.05%	61.08%	NA
Indica III	913	3.10%	47.90%	9.97%	39.10%	NA
Indica Intermediate	786	4.20%	34.00%	14.25%	47.58%	NA
Temperate Japonica	767	85.40%	0.00%	2.09%	12.52%	NA
Tropical Japonica	504	72.20%	1.40%	3.57%	22.82%	NA
Japonica Intermediate	241	58.10%	1.70%	4.15%	36.10%	NA
VI/Aromatic	96	87.50%	1.00%	7.29%	4.17%	NA
Intermediate	90	47.80%	7.80%	16.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223765446	T -> C	LOC_Os12g38690.1	upstream_gene_variant ; 2876.0bp to feature; MODIFIER	silent_mutation	Average:16.794; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765446	T -> C	LOC_Os12g38690-LOC_Os12g38700	intergenic_region ; MODIFIER	silent_mutation	Average:16.794; most accessible tissue: Callus, score: 31.294	N	N	N	N
vg1223765446	T -> DEL	N	N	silent_mutation	Average:16.794; most accessible tissue: Callus, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223765446	NA	2.13E-16	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	1.29E-19	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	5.02E-06	6.64E-34	mr1670	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	7.59E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	4.10E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	1.48E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	3.97E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	6.18E-21	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223765446	NA	4.58E-13	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251