\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223731338:

Variant ID: vg1223731338 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23731338
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTTCTTTTCCAGATTCTCTGTACATCTAGTCTCATCTCCTCATCAAGTAAAACCCAGCTAAATAGAGGCAAAAAAAAATTCAACATTCTTGCAGTTG[C/T]
AGTGTAAGAACATCTCATGGGGTATGCATTGCACAACCTGATATGCAAGTATAGAACAAACAAATTGATGCTTACGCACATACCCTCCAAGTCTATATTT

Reverse complement sequence

AAATATAGACTTGGAGGGTATGTGCGTAAGCATCAATTTGTTTGTTCTATACTTGCATATCAGGTTGTGCAATGCATACCCCATGAGATGTTCTTACACT[G/A]
CAACTGCAAGAATGTTGAATTTTTTTTTGCCTCTATTTAGCTGGGTTTTACTTGATGAGGAGATGAGACTAGATGTACAGAGAATCTGGAAAAGAAATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.80% 0.06% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 85.50% 14.30% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 87.90% 11.70% 0.39% 0.00% NA
Tropical Japonica  504 90.90% 9.10% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 33.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223731338 C -> T LOC_Os12g38620.1 upstream_gene_variant ; 1554.0bp to feature; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N
vg1223731338 C -> T LOC_Os12g38620.3 upstream_gene_variant ; 1554.0bp to feature; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N
vg1223731338 C -> T LOC_Os12g38620.2 upstream_gene_variant ; 1554.0bp to feature; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N
vg1223731338 C -> T LOC_Os12g38640.1 downstream_gene_variant ; 4408.0bp to feature; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N
vg1223731338 C -> T LOC_Os12g38640.2 downstream_gene_variant ; 4408.0bp to feature; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N
vg1223731338 C -> T LOC_Os12g38630.1 intron_variant ; MODIFIER silent_mutation Average:59.628; most accessible tissue: Callus, score: 70.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223731338 NA 1.91E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223731338 1.64E-07 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223731338 NA 5.17E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223731338 1.82E-06 1.82E-06 mr1750 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223731338 NA 9.19E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251