\
| Variant ID: vg1223702973 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23702973 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.19, others allele: 0.00, population size: 96. )
CTAGCTGCATGCTGTTTTTAATCATCGTAATTTGTTTTTGGAAGCATGCGATTAAACAGGTATAGCTAGTAAGCTAAGATAATCTGCTGCTGGTATGCAT[G/A]
TGTGCTAAATTAAGTTCATCTCTTATTTTTCTTCCTTTGCATATTTGACCGTTAATTTTTACACTTTAACTATTTGTTTTTACTTACTTGGCTTACTTCT
AGAAGTAAGCCAAGTAAGTAAAAACAAATAGTTAAAGTGTAAAAATTAACGGTCAAATATGCAAAGGAAGAAAAATAAGAGATGAACTTAATTTAGCACA[C/T]
ATGCATACCAGCAGCAGATTATCTTAGCTTACTAGCTATACCTGTTTAATCGCATGCTTCCAAAAACAAATTACGATGATTAAAAACAGCATGCAGCTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 8.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223702973 | G -> A | LOC_Os12g38590.1 | upstream_gene_variant ; 469.0bp to feature; MODIFIER | silent_mutation | Average:68.454; most accessible tissue: Callus, score: 91.923 | N | N | N | N |
| vg1223702973 | G -> A | LOC_Os12g38580.1 | downstream_gene_variant ; 97.0bp to feature; MODIFIER | silent_mutation | Average:68.454; most accessible tissue: Callus, score: 91.923 | N | N | N | N |
| vg1223702973 | G -> A | LOC_Os12g38580-LOC_Os12g38590 | intergenic_region ; MODIFIER | silent_mutation | Average:68.454; most accessible tissue: Callus, score: 91.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223702973 | NA | 3.62E-34 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 1.34E-29 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 3.80E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 6.64E-32 | mr1148 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 4.31E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 2.69E-23 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 3.51E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 1.76E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 6.24E-22 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 5.34E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 2.61E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 4.05E-23 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 4.57E-07 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 4.08E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 1.15E-52 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 1.10E-32 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 2.61E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 7.45E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 3.78E-22 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 7.58E-07 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 9.83E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 8.95E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 4.25E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223702973 | NA | 6.91E-24 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |