\
| Variant ID: vg1223681739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23681739 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 254. )
CGTTCCACACCAAAATGTTCTCGTTGCATGATCCCATTGAGGGGGACCACACCGAGAGCAGAAGAGAAGAAACCGATCAGCCGCACACGACCAACTCCTC[C/T]
GCAGCCTTGGCCGGGGGCAAGGAGCTAGAGAAGAGCGAGGAGAGCGCGATGATGTGCTCCTGGGAAAGTGGCTTGGAGAAGAGGGCGTTGTAAGCCGCGA
TCGCGGCTTACAACGCCCTCTTCTCCAAGCCACTTTCCCAGGAGCACATCATCGCGCTCTCCTCGCTCTTCTCTAGCTCCTTGCCCCCGGCCAAGGCTGC[G/A]
GAGGAGTTGGTCGTGTGCGGCTGATCGGTTTCTTCTCTTCTGCTCTCGGTGTGGTCCCCCTCAATGGGATCATGCAACGAGAACATTTTGGTGTGGAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 8.50% | 0.85% | 1.12% | NA |
| All Indica | 2759 | 96.80% | 0.40% | 1.05% | 1.74% | NA |
| All Japonica | 1512 | 73.80% | 25.40% | 0.60% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.00% | 1.34% | 0.34% | NA |
| Indica II | 465 | 98.30% | 0.20% | 0.65% | 0.86% | NA |
| Indica III | 913 | 94.60% | 0.70% | 1.20% | 3.50% | NA |
| Indica Intermediate | 786 | 97.50% | 0.40% | 0.89% | 1.27% | NA |
| Temperate Japonica | 767 | 91.30% | 8.00% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 54.60% | 44.60% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 58.50% | 40.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223681739 | C -> DEL | N | N | silent_mutation | Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg1223681739 | C -> T | LOC_Os12g38560.1 | downstream_gene_variant ; 4344.0bp to feature; MODIFIER | silent_mutation | Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg1223681739 | C -> T | LOC_Os12g38560-LOC_Os12g38570 | intergenic_region ; MODIFIER | silent_mutation | Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223681739 | NA | 4.55E-13 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1223681739 | 2.03E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 8.93E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | 4.06E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 7.51E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 2.92E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | 1.42E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 2.93E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 2.00E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | 2.52E-09 | NA | mr1778_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223681739 | NA | 1.02E-21 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |