\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223681739:

Variant ID: vg1223681739 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23681739
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTCCACACCAAAATGTTCTCGTTGCATGATCCCATTGAGGGGGACCACACCGAGAGCAGAAGAGAAGAAACCGATCAGCCGCACACGACCAACTCCTC[C/T]
GCAGCCTTGGCCGGGGGCAAGGAGCTAGAGAAGAGCGAGGAGAGCGCGATGATGTGCTCCTGGGAAAGTGGCTTGGAGAAGAGGGCGTTGTAAGCCGCGA

Reverse complement sequence

TCGCGGCTTACAACGCCCTCTTCTCCAAGCCACTTTCCCAGGAGCACATCATCGCGCTCTCCTCGCTCTTCTCTAGCTCCTTGCCCCCGGCCAAGGCTGC[G/A]
GAGGAGTTGGTCGTGTGCGGCTGATCGGTTTCTTCTCTTCTGCTCTCGGTGTGGTCCCCCTCAATGGGATCATGCAACGAGAACATTTTGGTGTGGAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 8.50% 0.85% 1.12% NA
All Indica  2759 96.80% 0.40% 1.05% 1.74% NA
All Japonica  1512 73.80% 25.40% 0.60% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 0.00% 1.34% 0.34% NA
Indica II  465 98.30% 0.20% 0.65% 0.86% NA
Indica III  913 94.60% 0.70% 1.20% 3.50% NA
Indica Intermediate  786 97.50% 0.40% 0.89% 1.27% NA
Temperate Japonica  767 91.30% 8.00% 0.65% 0.13% NA
Tropical Japonica  504 54.60% 44.60% 0.40% 0.40% NA
Japonica Intermediate  241 58.50% 40.70% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223681739 C -> DEL N N silent_mutation Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1223681739 C -> T LOC_Os12g38560.1 downstream_gene_variant ; 4344.0bp to feature; MODIFIER silent_mutation Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1223681739 C -> T LOC_Os12g38560-LOC_Os12g38570 intergenic_region ; MODIFIER silent_mutation Average:43.431; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223681739 NA 4.55E-13 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223681739 2.03E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 8.93E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 4.06E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 7.51E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 2.92E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 1.42E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 2.93E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 2.00E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 2.52E-09 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223681739 NA 1.02E-21 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251